ID: 1143426173

View in Genome Browser
Species Human (GRCh38)
Location 17:6840310-6840332
Sequence TACCTTACATAATGAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143426173_1143426176 -9 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG No data
1143426173_1143426178 4 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426178 17:6840337-6840359 ACTTGCAGGGCATGACCTCAGGG No data
1143426173_1143426177 3 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426177 17:6840336-6840358 AACTTGCAGGGCATGACCTCAGG No data
1143426173_1143426175 -10 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426175 17:6840323-6840345 ATGTAAGGTATATAACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143426173 Original CRISPR TACCTTACATAATGAGGCAC TGG (reversed) Intergenic
No off target data available for this crispr