ID: 1143426174

View in Genome Browser
Species Human (GRCh38)
Location 17:6840316-6840338
Sequence GTTATATACCTTACATAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143426174_1143426177 -3 Left 1143426174 17:6840316-6840338 CCTCATTATGTAAGGTATATAAC No data
Right 1143426177 17:6840336-6840358 AACTTGCAGGGCATGACCTCAGG No data
1143426174_1143426180 28 Left 1143426174 17:6840316-6840338 CCTCATTATGTAAGGTATATAAC No data
Right 1143426180 17:6840367-6840389 TAGTTGCCTGAACTTTCTAATGG No data
1143426174_1143426178 -2 Left 1143426174 17:6840316-6840338 CCTCATTATGTAAGGTATATAAC No data
Right 1143426178 17:6840337-6840359 ACTTGCAGGGCATGACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143426174 Original CRISPR GTTATATACCTTACATAATG AGG (reversed) Intergenic
No off target data available for this crispr