ID: 1143426176

View in Genome Browser
Species Human (GRCh38)
Location 17:6840324-6840346
Sequence TGTAAGGTATATAACTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143426169_1143426176 25 Left 1143426169 17:6840276-6840298 CCTATTTTTAATTGGGAATTTTT No data
Right 1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG No data
1143426173_1143426176 -9 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143426176 Original CRISPR TGTAAGGTATATAACTTGCA GGG Intergenic
No off target data available for this crispr