ID: 1143426178

View in Genome Browser
Species Human (GRCh38)
Location 17:6840337-6840359
Sequence ACTTGCAGGGCATGACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143426173_1143426178 4 Left 1143426173 17:6840310-6840332 CCAGTGCCTCATTATGTAAGGTA No data
Right 1143426178 17:6840337-6840359 ACTTGCAGGGCATGACCTCAGGG No data
1143426174_1143426178 -2 Left 1143426174 17:6840316-6840338 CCTCATTATGTAAGGTATATAAC No data
Right 1143426178 17:6840337-6840359 ACTTGCAGGGCATGACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143426178 Original CRISPR ACTTGCAGGGCATGACCTCA GGG Intergenic
No off target data available for this crispr