ID: 1143434496

View in Genome Browser
Species Human (GRCh38)
Location 17:6913868-6913890
Sequence TGGGATACACACCCCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 4, 1: 1, 2: 10, 3: 25, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143434490_1143434496 10 Left 1143434490 17:6913835-6913857 CCCAGAGTGTGAGAGGGGAAGAG 0: 1
1: 3
2: 22
3: 107
4: 498
Right 1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG 0: 4
1: 1
2: 10
3: 25
4: 227
1143434491_1143434496 9 Left 1143434491 17:6913836-6913858 CCAGAGTGTGAGAGGGGAAGAGT 0: 1
1: 3
2: 12
3: 57
4: 299
Right 1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG 0: 4
1: 1
2: 10
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143434496 Original CRISPR TGGGATACACACCCCCACCA GGG Intronic
901144275 1:7054560-7054582 CGGCATGCACAGCCCCACCAGGG - Intronic
901759660 1:11462464-11462486 TGCGATACACACCCCCTCACAGG + Intergenic
904867123 1:33588891-33588913 TGAGACACACATCCCCGCCATGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908034220 1:60034583-60034605 TGGTGTAAATACCCCCACCATGG + Intronic
908665161 1:66481650-66481672 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
909119331 1:71581214-71581236 TGGTATAAACATTCCCACCATGG - Intronic
910429718 1:87148695-87148717 TGGGTTTCACAGCCCCACCTTGG + Intronic
912168965 1:107074559-107074581 TGTGATACACACGCACACCATGG + Intergenic
912761689 1:112373092-112373114 TGTTATACACACACACACCATGG + Intergenic
916868489 1:168887116-168887138 TGGGACACACAGCCCCTCCAGGG + Intergenic
918716743 1:187798340-187798362 TGGGATACCCACCCCAACTTGGG - Intergenic
919454246 1:197803058-197803080 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
921119762 1:212126440-212126462 GGACATACACACCCCAACCAGGG - Intergenic
922721946 1:227903852-227903874 TGGGGTACACAGCCTCACCCTGG + Intergenic
923152503 1:231246207-231246229 TGGGATATACGCTCCCACCAGGG - Intronic
923992897 1:239458881-239458903 TGGGAGACCCCCCCCCATCAGGG + Intronic
1062787587 10:278303-278325 TGGGAAACACACCCCCACTCAGG - Intronic
1063126987 10:3144077-3144099 AGGAGGACACACCCCCACCAGGG + Intronic
1063556734 10:7087417-7087439 TGGGACACAGACACACACCAAGG + Intergenic
1064370408 10:14747747-14747769 TGGGTGAGACACCCCCAACAGGG - Intronic
1064729512 10:18315812-18315834 TGGTATAAATACTCCCACCATGG + Intronic
1064802648 10:19093869-19093891 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1066164610 10:32772808-32772830 TGGCATACACACCCCCACCAGGG - Intronic
1066598505 10:37078166-37078188 TGTGATACACACACACACGAGGG - Intergenic
1066684754 10:37970083-37970105 TGGTATAAATACTCCCACCATGG - Intronic
1067984579 10:51128087-51128109 TGGGATACATGCCCCAAACATGG - Intronic
1070325832 10:75388309-75388331 TGGTATAAATACTCCCACCATGG + Intergenic
1070761636 10:79027774-79027796 TGTGGTCCACACACCCACCACGG + Intergenic
1070993477 10:80753905-80753927 TGGTATAAACACTCCCAGCATGG + Intergenic
1071248000 10:83786337-83786359 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1071352589 10:84762142-84762164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1074044710 10:109826553-109826575 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1075590809 10:123689979-123690001 TGGTATAAACACTCCCACCGTGG - Exonic
1077244746 11:1531069-1531091 TGGGATGCACACCCGCACCCTGG + Intergenic
1078120610 11:8505025-8505047 TGGTATAAGCACACCCACCATGG - Intronic
1079110187 11:17601042-17601064 TGGCGTAAACACTCCCACCAGGG - Intronic
1079115548 11:17638499-17638521 GGGGCTCCACACCTCCACCAGGG - Exonic
1079952265 11:26819793-26819815 TGGAACACACACCCCCACTAGGG - Intergenic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1081485866 11:43528199-43528221 TGGTGTAAACACTCCCACCATGG - Intergenic
1082558085 11:54586721-54586743 TGGGAGGCACCCCCCCACTAGGG - Intergenic
1084041904 11:66547298-66547320 TGGGCTCCCCACCCCCACCAGGG + Intronic
1084114570 11:67034585-67034607 GTGGATACAGACCCCCACCCGGG - Intronic
1085222005 11:74882788-74882810 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1086836169 11:91625815-91625837 TGGGAAGCACACACCCACAATGG - Intergenic
1086877143 11:92111070-92111092 TGGGATATACACTCCCACTGGGG + Intergenic
1087067163 11:94037583-94037605 TGGGAGGCACCCCCCCAACAGGG + Intronic
1087386896 11:97483125-97483147 TTGCAGACACACCCACACCAGGG + Intergenic
1087468743 11:98545380-98545402 TGGAACACACACCCCCATTAGGG + Intergenic
1087908227 11:103724252-103724274 CAGGGTACAGACCCCCACCATGG + Intergenic
1090621330 11:128563614-128563636 TTGGATAAACAGCCACACCACGG + Intronic
1091356583 11:134942203-134942225 TGGGAAACACACCCCCAAGCTGG - Intergenic
1093534231 12:20203236-20203258 TAGGATACATACTCCTACCAGGG - Intergenic
1093693765 12:22137259-22137281 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1094744824 12:33332579-33332601 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1095793755 12:46195356-46195378 TGGGAAACACCTCCCCATCAGGG - Intronic
1096588586 12:52642449-52642471 TGGGCCACACCCTCCCACCAGGG - Intergenic
1098296136 12:69006033-69006055 TGGGTTACACAACTCTACCATGG - Intergenic
1098722281 12:73915773-73915795 TGGTATAAATACTCCCACCATGG + Intergenic
1099744904 12:86689751-86689773 TGGGAGACACATCCCAGCCAGGG - Intronic
1100278591 12:93095606-93095628 TGGTGTAAACACTCCCACCATGG + Intergenic
1108502339 13:51080098-51080120 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1109312373 13:60710478-60710500 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1109719521 13:66259042-66259064 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1110007069 13:70286273-70286295 TGTGATACACACACACACAATGG + Intergenic
1113104853 13:106760604-106760626 TTGGAGACACACCCCCGCCCAGG - Intergenic
1114669706 14:24402664-24402686 TGGCATAAATACTCCCACCATGG - Intronic
1115252781 14:31366840-31366862 TGGGTTTTACACCCCTACCATGG - Intronic
1116322887 14:43492904-43492926 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1117663612 14:58033266-58033288 TGGGAGGCACCCCCCCAGCAGGG + Intronic
1119095548 14:71826980-71827002 TGGTGTAAATACCCCCACCATGG - Intergenic
1120714419 14:87824859-87824881 TGGCATTGACACCACCACCAAGG - Intergenic
1121018030 14:90560241-90560263 TGGTATAAACACTTCCACCATGG + Intronic
1122800799 14:104228620-104228642 TGGGATACCCACCCCTATCAGGG + Intergenic
1123143498 14:106105923-106105945 TGGGATACACATCCACACCTGGG - Intergenic
1125226737 15:37404727-37404749 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1128212245 15:65910854-65910876 TGAGATTCCCACTCCCACCATGG + Intronic
1128942228 15:71798426-71798448 TGGGAAGCACCCCCCCAGCAGGG - Intronic
1130296891 15:82653574-82653596 TGGCATAAAAACTCCCACCACGG + Intergenic
1130604750 15:85306205-85306227 CAGGGTATACACCCCCACCAGGG + Intergenic
1131315727 15:91335196-91335218 TGGTGTAAACACCCCAACCAGGG - Intergenic
1131331283 15:91501347-91501369 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1134137815 16:11691038-11691060 TGGGACTCTTACCCCCACCATGG + Intronic
1136144756 16:28310044-28310066 TGGGAAACCCTCCCCCACCACGG + Intronic
1136402586 16:30026618-30026640 TGGGAAGCACACCAGCACCATGG + Exonic
1137679939 16:50332764-50332786 TGCGGTACACACACACACCATGG + Intronic
1137743667 16:50804838-50804860 TGGTATAAATACCCCCACCACGG + Intergenic
1138233107 16:55354433-55354455 TGGAACATACCCCCCCACCAAGG + Intergenic
1140137233 16:72217921-72217943 TGGTATAAATATCCCCACCATGG + Intergenic
1140207534 16:72946027-72946049 TGGGATTCACACTCCCAGCAGGG - Intronic
1140577374 16:76186812-76186834 AGGGAAACCCACACCCACCATGG + Intergenic
1140580694 16:76227704-76227726 TGGTAGAGACACCCCCACCAAGG + Intergenic
1141303119 16:82836513-82836535 TGGGATACATACACCCACTTTGG - Intronic
1142397848 16:89842820-89842842 GGGGACCCACACCCCCACCGTGG + Intronic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1144276245 17:13671589-13671611 TGAGACATACACCCCCACTAGGG + Intergenic
1144825976 17:18105944-18105966 TGGGATCTTCACCCCTACCAAGG + Intronic
1146752569 17:35394666-35394688 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1147774859 17:42893478-42893500 TGGGATACAGACCAGGACCAAGG + Intergenic
1147845988 17:43404151-43404173 TGAGATGGACACCTCCACCAGGG + Intergenic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1153058904 18:976135-976157 TGGGAGGCACCCCCCCAACAGGG - Intergenic
1154395144 18:13981142-13981164 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1156176928 18:34557646-34557668 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1157096918 18:44694216-44694238 TGGTGTAAACACTCCCACCATGG + Intronic
1159322776 18:66875477-66875499 TGGGATACAAGCTTCCACCAAGG + Intergenic
1160969808 19:1762556-1762578 TGGGATCCACACACCCGCCAAGG - Intronic
1161395476 19:4042971-4042993 TCGGACACTCACCCCCACCCCGG + Intergenic
1162741017 19:12773798-12773820 TAGAATCCACACCCCCACCATGG + Intronic
1163824558 19:19515735-19515757 AGGGATACCCATCACCACCAGGG + Exonic
1165635103 19:37334002-37334024 TCGGATCCCCACCACCACCAGGG + Intronic
1166271927 19:41719793-41719815 TGTGATACACACACCTGCCATGG + Intronic
1166415157 19:42589851-42589873 TGTGACACACACACCCACCGTGG - Intronic
1166613912 19:44226187-44226209 TGGGAGACACCCCCCCAGTAGGG - Intronic
929214041 2:39391766-39391788 TGGTGTAAACACTCCCACCAAGG + Intronic
929903390 2:46025297-46025319 TGGAACACACACCCCCAGCCAGG + Intronic
931048733 2:58386817-58386839 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
931168912 2:59781449-59781471 TGGTATGCTCACCCCAACCAAGG - Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933349466 2:81135987-81136009 CAGGATATACACCACCACCAGGG + Intergenic
936782795 2:116054219-116054241 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
936879592 2:117233460-117233482 CAGGATACACATCCCCACAAAGG - Intergenic
937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG + Intronic
937809412 2:126183315-126183337 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
937831087 2:126424373-126424395 TGGTATACACAAACACACCATGG + Intergenic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
941093104 2:161201672-161201694 TGGGCTACAGAGCACCACCAGGG - Intronic
942038139 2:172031360-172031382 AGGGAGACACTCCCCTACCAGGG + Intronic
943446465 2:187993833-187993855 TGGGATACACACCCCCACTGGGG + Intergenic
944494890 2:200296781-200296803 TGTGGTACATACTCCCACCATGG - Intergenic
944602678 2:201319983-201320005 TGGAATACACACCCCCACTGTGG + Intronic
947589593 2:231378007-231378029 TGGTGTAAATACCCCCACCATGG - Intergenic
1168931586 20:1628831-1628853 TGGTATAATCACCCCCAACATGG - Intergenic
1168940993 20:1711515-1711537 GGGGATAGACACCCCCACCAGGG + Intergenic
1169075819 20:2759309-2759331 TGGGATTCACAGCCACACCCCGG + Exonic
1169519231 20:6353161-6353183 TGGTGTAAATACCCCCACCATGG + Intergenic
1170318113 20:15064415-15064437 TGGGCTACATAAGCCCACCAAGG + Intronic
1171183193 20:23106004-23106026 TGGTATAAATACCTCCACCAGGG + Intergenic
1174929596 20:54798458-54798480 TGTGGTACACACACACACCACGG - Intergenic
1176292557 21:5053949-5053971 TGGGATACACCCCCCCAACACGG - Intergenic
1176733104 21:10519976-10519998 TAGGATACAAAACCACACCATGG - Intergenic
1178423447 21:32460188-32460210 TGGTGTCCACACCCCCTCCAGGG + Intronic
1179381995 21:40908393-40908415 AGGCAGAGACACCCCCACCAGGG + Intergenic
1179864701 21:44209701-44209723 TGGGATACACCCCCCCAACATGG + Intergenic
1180504863 22:15985368-15985390 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1182831531 22:33308274-33308296 TGGGGAACTCACACCCACCAAGG + Intronic
1184524424 22:45013400-45013422 TGGGGTACACACCCATATCAGGG + Intergenic
1184903281 22:47461262-47461284 TGGTGTAAACACTCCCACCATGG - Intergenic
1184998858 22:48229590-48229612 TGGTGTAAATACCCCCACCAGGG - Intergenic
1185001987 22:48251835-48251857 TGGAGTACACATCCCCACGAGGG - Intergenic
1185148471 22:49151606-49151628 TGGGACACACAGGCCCAGCATGG - Intergenic
1203333797 22_KI270739v1_random:36678-36700 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
950145117 3:10643568-10643590 TGGGAAAGACAGCACCACCAAGG + Intronic
950289562 3:11772554-11772576 TGTGATACATACACACACCATGG - Intergenic
950900864 3:16496202-16496224 TGGTGTAAACACACCCACCATGG + Intronic
952592806 3:34977735-34977757 AGGTATACACACACACACCATGG - Intergenic
953982486 3:47419654-47419676 TGGTATACACAGACCCAGCAGGG - Exonic
954199024 3:49013265-49013287 TGGTATACACATAGCCACCATGG - Exonic
954497432 3:50978422-50978444 TGGGAGGCACCCCCCCAGCAGGG - Intronic
954962199 3:54576354-54576376 TGGGCTAGACCCTCCCACCAAGG - Intronic
955014082 3:55051382-55051404 TGGGAGGCACCCCCCCAGCAGGG - Intronic
957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG + Intergenic
958491399 3:94778550-94778572 TGGGATCCCCACACACACCAAGG - Intergenic
958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG + Intergenic
961146175 3:124595378-124595400 TGGTATAAATACTCCCACCATGG - Intronic
961339738 3:126209959-126209981 TGGGATACACAGCCAAACCCGGG - Intergenic
962713570 3:138107972-138107994 TGACATAAGCACCCCCACCATGG + Intronic
964636126 3:158859951-158859973 CAGGATACACACCCCCACTGAGG - Intergenic
966992124 3:185243135-185243157 TGGAACACACACCCCCACTGGGG - Intronic
969313813 4:6369811-6369833 TGGGGGACACAGCCCCGCCATGG - Intronic
969990737 4:11259969-11259991 TGAGATACTCACCTCCGCCAAGG + Intergenic
970117288 4:12711417-12711439 TGATATAAATACCCCCACCATGG + Intergenic
970283310 4:14481477-14481499 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
970284367 4:14493520-14493542 TGGGATTCACACCCTTACAAGGG + Intergenic
970384739 4:15544632-15544654 TGTGAAACACACTCCCACTATGG + Intronic
972206534 4:36779875-36779897 TGGCATAAATACCTCCACCATGG + Intergenic
974992840 4:69115332-69115354 TGAGCTTCCCACCCCCACCATGG - Intronic
979432424 4:120647739-120647761 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
981445070 4:144826581-144826603 TGGCATAAATACTCCCACCATGG + Intergenic
982020659 4:151200569-151200591 TGGGATAAATATTCCCACCATGG - Intronic
982581109 4:157180167-157180189 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
982673092 4:158345995-158346017 AGAGATAGACACCACCACCAAGG + Intronic
982836468 4:160125486-160125508 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
987577649 5:19752049-19752071 TTGAATACACACCCCCACTGGGG + Intronic
988499782 5:31774955-31774977 TGGTGTAAACACTCCCACCATGG + Intronic
989292764 5:39788377-39788399 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
991675143 5:69083394-69083416 TGGTGTACATACCCCCACCATGG - Intergenic
992620087 5:78584561-78584583 TGGGAGGCACCCCCCCAGCAGGG - Intronic
993973140 5:94444222-94444244 GGGTATACACACCTCTACCAGGG + Intronic
995186755 5:109280410-109280432 CAGGTTATACACCCCCACCAGGG + Intergenic
997025227 5:130052315-130052337 TGGGAACCACACCCCCACTGTGG - Intronic
1000222904 5:159231272-159231294 TGGTATAAATACTCCCACCAAGG - Intergenic
1001452293 5:171836139-171836161 TGGGACATATACTCCCACCATGG - Intergenic
1002657452 5:180762075-180762097 TGGGAGACACCCCCCCAGTAGGG - Intergenic
1003692998 6:8373313-8373335 TGTTATACCCAGCCCCACCATGG + Intergenic
1005656455 6:27943489-27943511 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1008929575 6:56924242-56924264 TGGTATAAACACTCCCATCATGG + Intronic
1012079240 6:94735472-94735494 TGGGATACACATCCCCACCCCGG + Intergenic
1014954053 6:127594008-127594030 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1018530445 6:164757585-164757607 TATGATACACACCACCACCATGG + Intergenic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1023397141 7:39761813-39761835 TGGGATGGACACCCGCAGCAGGG - Intergenic
1024278955 7:47702457-47702479 TGGTATACATACTCCCACCGTGG - Intronic
1025211332 7:57020812-57020834 CCGCTTACACACCCCCACCATGG + Intergenic
1026447666 7:70499576-70499598 TGGGAAACCCACCCTCTCCAAGG - Intronic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1027177487 7:75914214-75914236 TGGGCTTCACTCCCCAACCAAGG + Intronic
1030132018 7:106209443-106209465 TGGGAGGCACCCCCCCAACAGGG + Intergenic
1031064211 7:117086988-117087010 TGGGTTACACACCCTCACCCAGG + Intronic
1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG + Intronic
1036827068 8:11986009-11986031 TGGGATACACATCCCCACTAGGG + Intergenic
1040432871 8:47361395-47361417 TGGGATGCCCATCCCCACCCAGG - Intronic
1040615033 8:49026988-49027010 TGGTGTACATACGCCCACCAGGG + Intergenic
1041371299 8:57163908-57163930 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1043885787 8:85598934-85598956 TGGTATAAATACTCCCACCATGG + Intergenic
1044224710 8:89705360-89705382 TAGGGTATACACCCCCACTAGGG - Intergenic
1047108143 8:121757982-121758004 TGGGACACAGACCCCCACAAAGG - Intergenic
1047995909 8:130335688-130335710 TGGGAGACACAGCCTCAGCAGGG - Intronic
1048811152 8:138287677-138287699 TGGCACACACAGCCCCACCATGG + Intronic
1051388558 9:16539040-16539062 TGGTAAACACACACACACCATGG - Intronic
1052465221 9:28821413-28821435 TGGGATGCTCACCCCAACAAAGG + Intergenic
1054425488 9:65062720-65062742 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1055853449 9:80659387-80659409 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1056051515 9:82774625-82774647 TGGGAGGCACCCCCCCAGCAGGG - Intergenic
1056967668 9:91178527-91178549 TGGGCTAAACACCCCCAGGATGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1060553877 9:124498621-124498643 TGGGGTCCTCATCCCCACCAGGG + Intronic
1062711306 9:137976522-137976544 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711323 9:137976619-137976641 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711340 9:137976717-137976739 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711356 9:137976814-137976836 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711371 9:137976911-137976933 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711388 9:137977008-137977030 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711403 9:137977105-137977127 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711421 9:137977202-137977224 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711436 9:137977299-137977321 TGGGAAACACACTGCCTCCAAGG - Intronic
1062711454 9:137977396-137977418 TGGGAAACACACTGCCTCCAAGG - Intronic
1185603323 X:1353966-1353988 TGGGACCCCCACCCCCATCATGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1186041231 X:5481175-5481197 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1186475381 X:9853169-9853191 TGGGGTACCCAACCCCTCCACGG - Intronic
1187580517 X:20602783-20602805 TGGTGTAAATACCCCCACCATGG + Intergenic
1188094095 X:26001782-26001804 GGGGATACACACTCCCACCAGGG + Intergenic
1188870293 X:35363983-35364005 TGGGATACACATCCCCACTAGGG + Intergenic
1189049889 X:37633835-37633857 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1190582329 X:51901432-51901454 TGTGATACACACACACACAATGG - Intronic
1191616558 X:63176245-63176267 TGGGATACACACCCCTCCCAGGG + Intergenic
1191619739 X:63202678-63202700 TGGGATACACACCCCTCCCAGGG - Intergenic
1191865555 X:65700837-65700859 TGGTATAAATACTCCCACCATGG + Intronic
1192393220 X:70752991-70753013 TGGTTTAAACACCCCCTCCACGG - Intronic
1193300639 X:79885130-79885152 CAGAATACACATCCCCACCAGGG + Intergenic
1193549503 X:82872714-82872736 TGGGATATACACCCTCACTGTGG - Intergenic
1194114106 X:89874151-89874173 AGTGATACACACCTTCACCATGG - Intergenic
1194556467 X:95367100-95367122 TGGGATATATACCTCAACCAGGG + Intergenic
1195088923 X:101440383-101440405 TGGGAGGCACCCCCCCAGCAGGG - Intronic
1195684015 X:107569664-107569686 TGGTGTACATACACCCACCATGG - Intronic
1195770802 X:108349034-108349056 TGGTATAAATACTCCCACCAAGG - Intronic
1195983722 X:110606557-110606579 TGGGAGGCACCCCCCCAGCAGGG + Intergenic
1199438182 X:147837788-147837810 TGGGGTAAATACTCCCACCATGG - Intergenic
1200466847 Y:3529507-3529529 AGTGATACACACCTCCACCATGG - Intergenic
1200583103 Y:4973970-4973992 TGGGAGGCACCCCCCCAGCAGGG + Intergenic