ID: 1143439398

View in Genome Browser
Species Human (GRCh38)
Location 17:6957447-6957469
Sequence CAGGTTCTGCGGGGGTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143439398_1143439410 8 Left 1143439398 17:6957447-6957469 CCACTAAACCCCCGCAGAACCTG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1143439410 17:6957478-6957500 CGGCCCTGGGAGGTTCAATGTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1143439398_1143439409 -2 Left 1143439398 17:6957447-6957469 CCACTAAACCCCCGCAGAACCTG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1143439409 17:6957468-6957490 TGGAAAGGCTCGGCCCTGGGAGG 0: 1
1: 0
2: 2
3: 14
4: 191
1143439398_1143439407 -5 Left 1143439398 17:6957447-6957469 CCACTAAACCCCCGCAGAACCTG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1143439407 17:6957465-6957487 ACCTGGAAAGGCTCGGCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 136
1143439398_1143439413 13 Left 1143439398 17:6957447-6957469 CCACTAAACCCCCGCAGAACCTG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1143439413 17:6957483-6957505 CTGGGAGGTTCAATGTGGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 228
1143439398_1143439406 -6 Left 1143439398 17:6957447-6957469 CCACTAAACCCCCGCAGAACCTG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1143439406 17:6957464-6957486 AACCTGGAAAGGCTCGGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143439398 Original CRISPR CAGGTTCTGCGGGGGTTTAG TGG (reversed) Intronic
900429614 1:2595532-2595554 CAGGCTCTGGGGAGGTTTAATGG + Intronic
902755171 1:18544695-18544717 CAGGGTCTCAGGGGGTTTAGTGG - Intergenic
903818579 1:26083347-26083369 CAGGTTCACCTGGGGTTTGGAGG - Intergenic
905906201 1:41619995-41620017 CAGGCTCTGCAGGGGTTTGGGGG + Intronic
910099545 1:83561349-83561371 CAGGTTCTGTGAGGGTGTTGGGG - Intergenic
911528867 1:99019750-99019772 CAAGTACTGTTGGGGTTTAGGGG + Intergenic
912922515 1:113883062-113883084 CAAGATCTGTGGGGATTTAGGGG + Intronic
917456156 1:175187743-175187765 CAGGTTCAGAGGTGGTGTAGGGG - Intronic
1066378854 10:34884371-34884393 CAGGTTGTGCCGGGCTTTATAGG - Intergenic
1069092827 10:64223144-64223166 CAGGTCCTGCGAGGGCTGAGTGG - Intergenic
1072268129 10:93750025-93750047 CAGGTTCTGCTTGAGTTTAAAGG + Intergenic
1073589582 10:104743716-104743738 CAGGTTCACAGGGGGCTTAGGGG - Intronic
1074735765 10:116431123-116431145 CAGGTTCTGCATGGATTTTGAGG - Intronic
1075402196 10:122169017-122169039 CAGGTTGGACAGGGGTTTAGGGG + Intronic
1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG + Intergenic
1075603621 10:123788733-123788755 CAGGTTCAGGGAGGTTTTAGGGG + Intronic
1077476201 11:2791667-2791689 GAGGTTGTGCGGGGGCTTGGCGG + Intronic
1083269166 11:61562657-61562679 CAGGTCCTGGGAGGGTTCAGGGG - Intronic
1083689928 11:64401317-64401339 GAGGTTATGCAGGGGTTCAGCGG + Intergenic
1089764259 11:120751558-120751580 CAGGCTCTGGGTGGGTTTGGGGG + Intronic
1090445395 11:126760647-126760669 CAGGATCTGCAGGAGTTGAGAGG + Intronic
1093104947 12:15075086-15075108 CAGGTTCTGAGGTGGTTCTGGGG - Intergenic
1095990983 12:48034429-48034451 CAGGTTTTGAGGGGGTTCAAGGG + Intergenic
1097333865 12:58360449-58360471 CAGTTTCTGCATGGGTTGAGTGG + Intergenic
1097782226 12:63721222-63721244 CTAGTTCAGAGGGGGTTTAGGGG + Intergenic
1099172889 12:79386503-79386525 CAGGGTCTGTGGGGGTTGGGGGG - Intronic
1105408443 13:20150714-20150736 CAGGCTCTGCGGGGCCTCAGGGG - Intronic
1122745262 14:103894061-103894083 CAGGTTCTGGGAGGGCTGAGGGG + Intergenic
1126962398 15:54011805-54011827 CAGGCTCTGCAGGGGATTTGGGG - Intergenic
1128052101 15:64673690-64673712 CAGATTCTGCATGGTTTTAGAGG + Intronic
1128626624 15:69213751-69213773 CAGCTTCTGTGGTGTTTTAGTGG + Intronic
1129221119 15:74132222-74132244 CAACTTCTGCAGGGGTTTAGAGG - Intronic
1130613359 15:85380914-85380936 CGGGGGCTGCGGGGGTTTCGGGG + Intronic
1133491984 16:6279131-6279153 TAGGTTCTGGGGGTGTTTATGGG + Intronic
1135904134 16:26494979-26495001 CAGGTTCTGCAAGGGTGTCGAGG + Intergenic
1139336758 16:66237525-66237547 CATGTTTTGCGGGGGTTTTCTGG + Intergenic
1139559422 16:67732312-67732334 CAGCTTCTGCTGGGGTTAAATGG - Intronic
1141920118 16:87130030-87130052 CAGGTTCTGATGGGGGTGAGTGG - Intronic
1143439398 17:6957447-6957469 CAGGTTCTGCGGGGGTTTAGTGG - Intronic
1147157583 17:38552000-38552022 CAGGTTCAGCGGGGGGCTGGGGG + Exonic
1152864028 17:82711654-82711676 CAGGCTCTGCGGCGGTGTCGTGG + Intergenic
1157342491 18:46791786-46791808 GAGGTTCTGCAGGGGTTGGGAGG - Intergenic
1161496100 19:4586690-4586712 CAGGGTCTGCGGGGCTGCAGAGG - Intergenic
1162548146 19:11343350-11343372 GAGGTTTTGCGGGGGGATAGAGG - Intronic
1165017347 19:32890729-32890751 CAGGGCCTGCAGGGGTTGAGGGG - Intronic
1166732696 19:45067856-45067878 CAGGTTCTGTGGGGTCTGAGAGG + Intronic
1167258072 19:48442913-48442935 CGGCTTCTGCGGGGGCTGAGCGG - Exonic
1167960189 19:53098861-53098883 CAGGGTCTGCGGGGCTTTTCAGG + Intronic
1167963976 19:53128669-53128691 CAGGGTCTGCGGGGCTTTTCAGG + Intronic
1168382168 19:55933159-55933181 CAGGTTCTATGGGGGAATAGTGG - Intergenic
1168449738 19:56456976-56456998 CAGGTTCTGAGGGTGTGTAACGG - Intronic
927241000 2:20919393-20919415 CAGGTCCTGCGGGTGGGTAGTGG + Intergenic
930632871 2:53772879-53772901 CAGGTTCTACTGGGGTCTACGGG - Intronic
931123531 2:59248049-59248071 CAAGTTCTGGGGAGATTTAGTGG - Intergenic
933444007 2:82353998-82354020 CAGGACCTGTAGGGGTTTAGGGG - Intergenic
935661145 2:105468012-105468034 CTGGTTTTGGTGGGGTTTAGTGG - Intergenic
936146178 2:109981842-109981864 CAGGGTCTGCAGGATTTTAGGGG + Intergenic
936198513 2:110389637-110389659 CAGGGTCTGCAGGATTTTAGGGG - Intergenic
936393008 2:112092676-112092698 CAGGTTCAGAGAAGGTTTAGGGG + Intronic
937139890 2:119590857-119590879 CAGTTTGTGCTGGGGTTTGGGGG - Intronic
937291840 2:120786461-120786483 CAGGTTGGGCGGGGGGTTGGAGG - Intronic
941072395 2:160969577-160969599 CGGGGTCTGGAGGGGTTTAGAGG - Intergenic
944123771 2:196270275-196270297 AAGCTTCTGCTGGGTTTTAGTGG + Intronic
947739022 2:232476475-232476497 CAGGTTCTGCGGGGGGAGATTGG - Intergenic
1169381621 20:5112634-5112656 CAGGTGCTGAGGGAGTTTGGGGG - Intronic
1171403250 20:24892809-24892831 CAGGCTTGGCAGGGGTTTAGAGG + Intergenic
1173262658 20:41450731-41450753 CAGGTTCTGCGGGAGAGCAGAGG + Intronic
1173873803 20:46357394-46357416 CAGGTGCAGGGGGGGTTTTGTGG + Intronic
1176043640 20:63081289-63081311 CAGGTTCTGCAGGGCTTCAGAGG - Intergenic
1178068879 21:28938892-28938914 CAGGAGCTGCGGGGTTTGAGAGG + Intronic
1179641751 21:42752248-42752270 CAGGTTCTGGGTGGATTTGGGGG + Intronic
1181064324 22:20298612-20298634 CAGGTTCCGAGGGGGCCTAGTGG + Intergenic
1183078280 22:35440480-35440502 CAGGTGCTACAGGGGTTGAGAGG + Intergenic
1183326767 22:37198772-37198794 CGGGGACTGCGGGGGTTTGGAGG - Intronic
1184766793 22:46576570-46576592 CAGGTACTGCGCGAGTCTAGCGG + Intronic
1185314250 22:50171872-50171894 CAGGGTCTGCTGAGGTTTGGAGG - Intronic
950291896 3:11791357-11791379 AAGGCTCTCCGGGGGCTTAGGGG + Intronic
950480979 3:13243567-13243589 CAGCTTCTACTGGGGTGTAGAGG - Intergenic
961818387 3:129562938-129562960 CAGGTTCTGCAGGGGGAGAGTGG + Exonic
970952205 4:21770122-21770144 CAGGGTCTGTTGGGGGTTAGGGG - Intronic
975377565 4:73663475-73663497 ATGGTTCTGTGTGGGTTTAGTGG - Intergenic
978304890 4:107316471-107316493 CAAGTTCTGCAGGCGTTTTGGGG - Intergenic
978406850 4:108389211-108389233 CAGGGCCTGCGGGGGGGTAGGGG + Intergenic
982637031 4:157909753-157909775 CAGCTTGTGCAGTGGTTTAGTGG - Intergenic
984620319 4:181944826-181944848 CAGGTGCTGCAGGGGTGTGGTGG - Intergenic
984677150 4:182562836-182562858 CAGGTACTGTGGGGGTCAAGGGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998403028 5:141857920-141857942 CAGGCTATGCTGGTGTTTAGAGG - Intronic
1000501458 5:162056238-162056260 CAGGGACTGCGGGAGTTTTGTGG + Intergenic
1002658802 5:180775849-180775871 CAGGTGCAGCAGGGGTTTGGAGG + Intergenic
1006103618 6:31702658-31702680 TAGGTTGGGCGGGGGTTGAGGGG + Intronic
1011536276 6:88379685-88379707 CAGGTTTTGCGGGGGTTCTGGGG + Intergenic
1011911342 6:92444156-92444178 CAGGGCCTGCGGGGGCTTGGGGG - Intergenic
1014133616 6:117863324-117863346 CAGGTGCTGCCGGGGATTATGGG + Intergenic
1018122640 6:160651174-160651196 CAGGTTCTGCAGGGCTTTGAAGG - Intronic
1019413252 7:915785-915807 TAGGTTCTGCAGGGGTATATGGG - Intronic
1019589917 7:1825805-1825827 CAGGTGCTGCTGGGGGTTAGAGG + Intronic
1022610454 7:31866873-31866895 CAGGGTCTGCCAGGGTTTAGGGG - Intronic
1022877004 7:34544622-34544644 TAGGGTCTCCGGGGGTTTACAGG - Intergenic
1022940819 7:35237322-35237344 CTAGTTCAGAGGGGGTTTAGGGG + Intronic
1023113710 7:36839917-36839939 CAGGTTCTACTGGTGTCTAGTGG + Intergenic
1033810146 7:145002324-145002346 CAGGGTCTGGGAGGGTTGAGGGG + Intergenic
1034106694 7:148496526-148496548 CAGGTTGTGGGAGGGATTAGAGG - Intergenic
1036696116 8:10976213-10976235 CATGTTGTGGGAGGGTTTAGTGG + Intronic
1039549122 8:38430419-38430441 CAGGGGCTGCTGGGGTTTTGAGG - Intronic
1039642210 8:39236575-39236597 CAGGTTTTGTGGGGGAGTAGGGG - Intronic
1042799221 8:72700183-72700205 CAGGTTCTGTTGGGGTTTGGGGG + Intronic
1047487179 8:125342015-125342037 CAGGTGGTGGGGGGGTTAAGGGG + Intronic
1048906832 8:139096691-139096713 CTGGCTCTGCAGGGGTTGAGTGG + Intergenic
1051091115 9:13409534-13409556 CAGGTCCTGTTGGGGGTTAGGGG - Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1059547880 9:115196964-115196986 CAGGGTCTGGGGTGGTTTGGGGG + Intronic
1061524133 9:131144304-131144326 CAGTTTCTGTGGGGCTTGAGAGG - Exonic
1062618968 9:137411091-137411113 CAGGTTCTGCGGTGGTCCAGGGG - Intronic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189030239 X:37442353-37442375 CAGGATCTGTGGGGGTGGAGGGG + Intronic
1189035840 X:37492831-37492853 CAGGATCTGCGGGGGTGGAAGGG + Intronic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic
1197083101 X:122441586-122441608 CAGGTTCTGCTAGGGCTGAGTGG + Intergenic
1197154633 X:123257085-123257107 AGGGTTCTGTGGGTGTTTAGAGG - Intronic
1198332489 X:135634515-135634537 CAGTTTCTCCTGGGGGTTAGGGG - Intergenic
1198364801 X:135929576-135929598 CAGTTTCTCCTGGGGGTTAGGGG - Intergenic
1200833710 Y:7712374-7712396 CATGTTCTGCTGGGCTTTGGAGG - Intergenic