ID: 1143441438

View in Genome Browser
Species Human (GRCh38)
Location 17:6977635-6977657
Sequence ATAAAATATCTGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5790
Summary {0: 1, 1: 6, 2: 65, 3: 691, 4: 5027}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143441434_1143441438 8 Left 1143441434 17:6977604-6977626 CCGTCACCAACGCAAGGGGATTT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG 0: 1
1: 6
2: 65
3: 691
4: 5027
1143441435_1143441438 2 Left 1143441435 17:6977610-6977632 CCAACGCAAGGGGATTTGATGTA 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG 0: 1
1: 6
2: 65
3: 691
4: 5027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143441438 Original CRISPR ATAAAATATCTGGCCAGGTG CGG Intronic
Too many off-targets to display for this crispr