ID: 1143444612

View in Genome Browser
Species Human (GRCh38)
Location 17:7000148-7000170
Sequence GTGAAGAAACAGTCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 289}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143444612_1143444617 3 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444617 17:7000174-7000196 AAGATGAGAGGAACTGGACCAGG 0: 1
1: 0
2: 2
3: 23
4: 285
1143444612_1143444621 24 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444621 17:7000195-7000217 GGGGCTCTAGTTCTCCCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1143444612_1143444622 25 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444622 17:7000196-7000218 GGGCTCTAGTTCTCCCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 147
1143444612_1143444618 4 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444618 17:7000175-7000197 AGATGAGAGGAACTGGACCAGGG 0: 1
1: 0
2: 2
3: 16
4: 280
1143444612_1143444616 -3 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444616 17:7000168-7000190 CACTTTAAGATGAGAGGAACTGG 0: 1
1: 0
2: 2
3: 16
4: 200
1143444612_1143444615 -9 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444615 17:7000162-7000184 TTTCTTCACTTTAAGATGAGAGG 0: 1
1: 1
2: 2
3: 29
4: 393
1143444612_1143444619 5 Left 1143444612 17:7000148-7000170 CCCTCACCAGACTGTTTCTTCAC 0: 1
1: 0
2: 5
3: 55
4: 289
Right 1143444619 17:7000176-7000198 GATGAGAGGAACTGGACCAGGGG 0: 1
1: 0
2: 0
3: 16
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143444612 Original CRISPR GTGAAGAAACAGTCTGGTGA GGG (reversed) Intronic
901327720 1:8378899-8378921 GTGAAGATGCAGTCTGCTGGGGG + Intronic
901706540 1:11077734-11077756 TTTGAGAAACAGGCTGGTGAAGG - Intronic
902613726 1:17612345-17612367 ATGAAGAGACAGTCAGATGAAGG - Intronic
903730570 1:25492013-25492035 GTGAAGCAGCAGTGTGGTGGAGG + Intronic
903854724 1:26330262-26330284 GGGAGGAAACAGGCTGGAGAGGG + Intronic
905067549 1:35196120-35196142 CTAAAGAAAAATTCTGGTGAAGG - Intergenic
905314889 1:37076091-37076113 GTGAAGAAGCTGGCTGGTAAAGG + Intergenic
910014554 1:82505683-82505705 CTGAAGATACAGTTTAGTGAAGG + Intergenic
911527885 1:99007197-99007219 GAGAAGAAAGTGACTGGTGATGG - Intergenic
914394438 1:147251307-147251329 GTGAAGAAGCAGACTGGCTAGGG - Intronic
918437165 1:184527347-184527369 TGGAAGAAACAGGCTGGTAAAGG + Intronic
919377958 1:196817651-196817673 GTGAGGCAACAGCCTGGTGGGGG - Intergenic
919387645 1:196941688-196941710 GTGAGGCAACAGCCTGGTGGGGG - Intronic
919598108 1:199589798-199589820 ATGAAGAAACAGTCTAGTAAAGG - Intergenic
920367537 1:205455989-205456011 GGGAAGAAAGAGATTGGTGAGGG - Intergenic
923457727 1:234179107-234179129 GTCAAGAAACAGAGTCGTGAAGG - Intronic
923782019 1:237033142-237033164 GTGAGGGGACAGGCTGGTGAAGG - Intergenic
924359126 1:243217639-243217661 GTGAGGAAATAGTCTCCTGAAGG + Intronic
924392144 1:243573349-243573371 GTGAAGCAACAGTATAGTGAGGG - Intronic
1063364304 10:5480577-5480599 GGGCAGAGTCAGTCTGGTGAAGG + Intergenic
1063616100 10:7601757-7601779 ATGAAGAGAAATTCTGGTGAGGG - Intronic
1064323350 10:14326921-14326943 GAGAAGACACATTCTGGTGGTGG - Intronic
1064927164 10:20582008-20582030 GAGAAGAATCTGGCTGGTGATGG + Intergenic
1066627266 10:37419507-37419529 GCGAAGAAACAGGCTAGTGGTGG - Intergenic
1066667812 10:37803346-37803368 GTGAGGACACAGTCTGGGGAAGG - Intronic
1067805859 10:49393150-49393172 GTGAAGAAAGCATCTGCTGATGG - Intronic
1067829996 10:49606120-49606142 GTGGAGAAGCAGGCTGGTGTTGG - Intergenic
1068345080 10:55765804-55765826 GTGAAGAAAGAGTAATGTGAAGG - Intergenic
1069641866 10:69961561-69961583 GAGAAGAAACAATCCAGTGATGG + Intronic
1072763539 10:98078204-98078226 GTGAAGAAACTGGCAGGAGATGG + Intergenic
1073818801 10:107236692-107236714 GTGATGAAACAGCTTGTTGAGGG + Intergenic
1075420373 10:122295857-122295879 GTGAATAAATAATCTGGTCATGG - Intronic
1078995986 11:16700482-16700504 GTGGAGAATGAGTCTGGGGATGG - Intronic
1079400414 11:20102378-20102400 GTGAAGACACAGACTGGGGCAGG + Intronic
1080456605 11:32425205-32425227 GGGAAGAAAAAGTTTGGTGAGGG + Intronic
1080808364 11:35677846-35677868 GTGAATAAACAAACTGGGGAAGG + Intronic
1080877767 11:36292289-36292311 CTGTACAATCAGTCTGGTGATGG + Intergenic
1082688930 11:56276350-56276372 CTGAAGATGCAGTCTGCTGAAGG + Exonic
1083059672 11:59856712-59856734 GTGGAAAAACAGGCTGGAGAAGG + Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1086250931 11:84813555-84813577 GAGAAGAAAAAGGCTGGTGTGGG + Intronic
1086658765 11:89388713-89388735 GTGTAGAAACAGTCATTTGAGGG - Intronic
1087026141 11:93651890-93651912 GTGAAGGAATAGGCTTGTGAAGG - Intergenic
1087211902 11:95453514-95453536 GTGAAAAGACATACTGGTGAGGG - Intergenic
1089501357 11:118933437-118933459 GTGAGGAAACTGCTTGGTGAAGG + Intronic
1090840489 11:130483391-130483413 GTGTAGAACCAGACTGGTGGGGG + Intergenic
1092243687 12:6851094-6851116 GTGAAGAAACTTCCTGGCGAGGG + Intronic
1092772113 12:11906180-11906202 GGAAAGAGAGAGTCTGGTGAAGG + Intergenic
1093068197 12:14681040-14681062 TTAAAAAAACAGTCTGCTGAGGG + Intronic
1094581581 12:31738701-31738723 GTGAACTCACAGTCTGGTGGGGG + Intergenic
1095280225 12:40342633-40342655 GGGAAGAAAAAGTTTGGTGATGG - Intronic
1097363827 12:58688690-58688712 ATGGAGAAACAGTGTGGTGCTGG + Intronic
1098856801 12:75662096-75662118 GAGAACAAACAATCTTGTGAAGG + Intergenic
1099417892 12:82416052-82416074 TTGAAGTTACAGTCTGGTGAAGG + Intronic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1101204642 12:102474447-102474469 GGGAAGAAAGAGGCTTGTGAGGG - Intronic
1101260987 12:103029484-103029506 TTGAAGAAACTGGCTTGTGAGGG - Intergenic
1102489404 12:113280366-113280388 GTGAAGATACAGATGGGTGATGG - Intronic
1104163788 12:126206369-126206391 GTGAAAAATCACTGTGGTGATGG + Intergenic
1104628045 12:130375938-130375960 GAGAAGGAACAGTCAGGTGTGGG - Intergenic
1104754472 12:131260458-131260480 GAGGAGAATGAGTCTGGTGAAGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1109285460 13:60403654-60403676 GAAAAGAAACAGGTTGGTGATGG + Intronic
1110367928 13:74708617-74708639 GTGAAGAAACAGCCTGCTGGAGG - Intergenic
1112751574 13:102588891-102588913 TTGCAGACTCAGTCTGGTGAAGG - Intergenic
1115525106 14:34272097-34272119 GTGAAGAGCGATTCTGGTGAGGG - Intronic
1115743212 14:36409788-36409810 GTGAGGCTACAGCCTGGTGAGGG + Intergenic
1118179209 14:63474376-63474398 GGGAAGAAATAGTTTGGTGGGGG + Intronic
1118767596 14:68920628-68920650 GTGCAGACACAGGCTGGTGGAGG - Intronic
1121038166 14:90723797-90723819 GGGAGGAGACAGTCTAGTGAGGG - Intronic
1121641134 14:95485620-95485642 GAGAGGAGACAGCCTGGTGAGGG - Intergenic
1122916538 14:104861682-104861704 GTGGAGATACAGGGTGGTGATGG - Intergenic
1126506195 15:49406807-49406829 GGGAAGACACAGTGTGGAGAGGG + Intronic
1127184153 15:56460575-56460597 GTTAAGAAGTAGTCAGGTGAAGG + Intronic
1127291888 15:57578833-57578855 GTGAAGATAATGTCTGATGAAGG + Intergenic
1127575184 15:60285008-60285030 GTCAAGAAACCATCAGGTGATGG - Intergenic
1127718402 15:61674364-61674386 GTGAATACACTGTCTGGTGGGGG - Intergenic
1128431145 15:67595428-67595450 GTGAAGCAAAGGTCTAGTGATGG + Intronic
1128772896 15:70295620-70295642 GTGAAGAAACAGTGTTGTGTGGG - Intergenic
1129065499 15:72900645-72900667 GGGAAGAAAGATGCTGGTGAAGG - Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1131194671 15:90346048-90346070 GTGAGGAAACAGTCACATGAGGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134151984 16:11812282-11812304 GTGAAGAATCTGGCTGGTCATGG + Intergenic
1134206398 16:12241824-12241846 GAGAGAAAACAGTCTGATGATGG - Intronic
1140598427 16:76443872-76443894 GTGAAAATAAATTCTGGTGATGG + Intronic
1142845543 17:2672656-2672678 CTGAAGAAACATTGTGGTCATGG - Exonic
1143444612 17:7000148-7000170 GTGAAGAAACAGTCTGGTGAGGG - Intronic
1143537811 17:7551612-7551634 GTGGAAAGACATTCTGGTGAGGG - Intronic
1144265267 17:13562552-13562574 CTGAAGAAACAGTATCCTGATGG + Intronic
1145259276 17:21345151-21345173 GTGCAGAAAGATTCTGGTGCTGG + Intergenic
1145317339 17:21742798-21742820 GTGCAGAAAGATTCTGGTGCTGG - Intergenic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1148699913 17:49581134-49581156 GTGAAGGAACAGGCTGGAGTGGG + Intronic
1149636531 17:58175165-58175187 GTGAGGAAAGTATCTGGTGAAGG - Intergenic
1149898201 17:60447813-60447835 GGGAAGAAACTTTTTGGTGAGGG - Exonic
1153729890 18:8000168-8000190 GTGAAGAATGTTTCTGGTGAGGG - Intronic
1156548806 18:37993256-37993278 GCTGAGAGACAGTCTGGTGAGGG - Intergenic
1157308926 18:46537427-46537449 GTAATGAGAGAGTCTGGTGATGG - Intronic
1157462614 18:47913297-47913319 GTGAAGAAACAATATTGTAAAGG - Intronic
1160259432 18:77278219-77278241 ATGAAAACACATTCTGGTGAAGG - Intergenic
1160278149 18:77459048-77459070 ATGAAGAATCAGGCTGGTGCAGG + Intergenic
1160832640 19:1110876-1110898 GTGATGGAACAGTCTGGTAGGGG + Exonic
1162526644 19:11210229-11210251 GTGAAGAGACAGTGAGGGGATGG - Intronic
1168326117 19:55539302-55539324 CTGAAATAACAGTCTGGTGTTGG - Intergenic
925245190 2:2376498-2376520 GAGAAGAAACATTCTGGTCTTGG + Intergenic
925459397 2:4047188-4047210 GTGATTAAACAGTCTGATGCAGG - Intergenic
925898713 2:8493534-8493556 CTGAACAAACAGGCTGATGAAGG + Intergenic
926909049 2:17832546-17832568 GTGAAGACACATTCTAGAGAAGG + Intergenic
927153754 2:20210321-20210343 GGGAAGAAACAGTCTGGTCCTGG + Intronic
929794034 2:45044884-45044906 GTCAGGAAACACTCTGGTGAGGG - Intergenic
930344919 2:50168134-50168156 ATGTACAAACAGTCTGGTGATGG + Intronic
931554646 2:63489032-63489054 ATGAAGCAACAGCCTGGTGTAGG + Intronic
931597949 2:63970806-63970828 GAGAAGAAAACGACTGGTGATGG - Intronic
935089855 2:99884811-99884833 GAGGAGACACATTCTGGTGAGGG + Intronic
935432819 2:102994709-102994731 ATGAATAAACAGTCTGGTTCTGG - Intergenic
935710634 2:105895043-105895065 GTGAATAGACATTCAGGTGAGGG + Intergenic
936260665 2:110957572-110957594 GTGAAGACACAGGCAGGAGATGG - Intronic
938302048 2:130222824-130222846 GTGAAGAATAAGGCTGGAGATGG + Intergenic
938454652 2:131451628-131451650 GTGAAGAATAAGGCTGGAGATGG - Intergenic
939045267 2:137242605-137242627 GTGGAGAAACAATCAGGTTAGGG - Intronic
941364865 2:164597998-164598020 GTGAAGAAACAGCATGGTTCAGG - Intronic
945160862 2:206889094-206889116 CTGGAAAAATAGTCTGGTGATGG + Intergenic
945239228 2:207660980-207661002 AAGTAGAAACAGTCTGGTGAAGG + Intergenic
948001309 2:234570085-234570107 GTGATCAAAAAGTCTGGTCATGG + Intergenic
948341150 2:237253109-237253131 CTGAAGTCTCAGTCTGGTGAAGG - Intergenic
948664763 2:239528015-239528037 GTGAAGACACACCCTCGTGATGG - Intergenic
1170816581 20:19719581-19719603 GTGAAGTAGCCGTCTGGGGAAGG + Intronic
1171299818 20:24050386-24050408 GAGGAGAAGCAGTCTGGTGGGGG + Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1175076979 20:56383603-56383625 GTGGAGAACCACTCTGGTGGTGG + Intronic
1175931499 20:62495912-62495934 GTGAGAAAACAGCCTGGGGAAGG - Intergenic
1176522459 21:7834696-7834718 GGGAAGAAACAGCCAGGTAAGGG - Intergenic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1177602845 21:23337380-23337402 GAGAAGAAAAAGTGAGGTGAGGG + Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178152862 21:29816000-29816022 GTGAAGAGACAATCTATTGATGG + Intronic
1178194535 21:30328716-30328738 GTTAATAAACAGTCTGCTCATGG + Intergenic
1178656479 21:34464708-34464730 GGGAAGAAACAGCCAGGTAAGGG - Intergenic
1179948425 21:44696102-44696124 GTGAAAAAACATTATTGTGAAGG - Intronic
1180692916 22:17732381-17732403 GGGAAGCAGCAGTCTGGTGTGGG - Intergenic
1183480490 22:38061900-38061922 GAGAGGAAACAGACTGGTCATGG - Intronic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184197793 22:42942781-42942803 TTCAAGAAACAGTGTGGTGCGGG - Intronic
949091054 3:29492-29514 GAGAAGATATAGTCTGGTGTTGG + Intergenic
950060092 3:10063706-10063728 GTGAAAAAACAGTCTTGAAAGGG + Intronic
951348522 3:21576164-21576186 GTGCAAAAATAGTCTGGTGTTGG - Intronic
951967718 3:28405782-28405804 GTTAAGAATGATTCTGGTGAGGG + Intronic
957010081 3:74994309-74994331 GTGTAGAAAGAGTCTGTTTAGGG - Intergenic
962280516 3:134048627-134048649 TTCAAGAAACAGTCTGGGAAGGG - Intronic
962535319 3:136324234-136324256 GTTAAGAAACAGGCTGGGCATGG - Intronic
964071256 3:152635900-152635922 ATGAAGAAAGACCCTGGTGAGGG - Intergenic
964475392 3:157093120-157093142 GTGAAGGACCAGACTGGTTATGG + Intergenic
966944928 3:184770986-184771008 GTCATGAAACAGTCTGGTGGTGG + Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
972871870 4:43310376-43310398 GTGAAGGAGCAGTCTGTTGTCGG - Intergenic
975809281 4:78149446-78149468 GTGAAGAATGAGACTGGTGCTGG - Intronic
976439923 4:85061420-85061442 GTGATGACACAGCCTGGAGATGG - Intergenic
977564442 4:98567139-98567161 GAGAAGATCCAGTCTGTTGATGG - Intronic
977767542 4:100817562-100817584 TTGAATAGACAGTCTGGTGAAGG + Intronic
977853551 4:101859953-101859975 GTGCAGAAACAGTCAAATGATGG + Intronic
978151733 4:105444167-105444189 ATGAATGAACAGTTTGGTGAAGG + Intronic
978697068 4:111595262-111595284 GTGTAGACAAAGTCTGGTCAAGG - Intergenic
981677224 4:147356227-147356249 GTGAAGTAACAGGATAGTGATGG - Intergenic
981763078 4:148215473-148215495 GTGGATAAACAGTATGGAGAAGG + Intronic
982328456 4:154155240-154155262 ATGAGGAAACAGTGGGGTGATGG - Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983865337 4:172759602-172759624 GTGAGGACACAGTCAGGTGGAGG - Intronic
983945540 4:173582379-173582401 GTGGAGAAACAGTGTGGTATGGG + Intergenic
984197052 4:176670804-176670826 GTTTAGAAAAAGGCTGGTGATGG + Intergenic
986207744 5:5641505-5641527 TTGAAGAAGCAATCCGGTGAGGG + Intergenic
988754710 5:34235263-34235285 GTGAACAAAAAGTCTAGTAATGG - Intergenic
989553491 5:42763471-42763493 GTGAAGACACAGTATGGAAAGGG + Intronic
996179000 5:120395739-120395761 CTGAAGAAACTCTCTGGTAAAGG - Intergenic
996210500 5:120802822-120802844 GAGGAGAAACAGTGTGGAGAAGG - Intergenic
996313433 5:122133927-122133949 GAGAAGAAACAGTCATATGAAGG - Intronic
996726260 5:126675457-126675479 GTGAATGCACAGCCTGGTGAGGG - Intergenic
998096112 5:139396296-139396318 GTGGAGAAACAATCTGGGAAGGG - Intergenic
999426234 5:151489862-151489884 GTGAAGCAAGAGCCTGGTGACGG - Exonic
999950279 5:156642083-156642105 GTGAAGATACAGTAAGATGATGG - Intronic
1000242454 5:159421171-159421193 GTGAAGTAACACTGTAGTGATGG + Intergenic
1003456649 6:6289162-6289184 GTGAGGAAACAGTAATGTGATGG + Intronic
1004942050 6:20568839-20568861 GTTAAGGAAGAGTCTGATGAGGG - Intronic
1005657615 6:27957916-27957938 TTGAGGATACAGTCTGCTGAAGG + Exonic
1008430492 6:51410910-51410932 GTGAAGAAACAATCTGCTTCTGG - Intergenic
1009030998 6:58057936-58057958 GTGAAGAGAGAATCTGGTGTGGG + Intergenic
1009206853 6:60812395-60812417 GTGAAGAGAGAATCTGGTGTGGG + Intergenic
1009360842 6:62810696-62810718 ATGAAGAAACAGTCAAGGGAAGG + Intergenic
1009475519 6:64086032-64086054 TTGAAGAAACAGTCTGCAAAAGG - Intronic
1013554028 6:111237892-111237914 GTGAATAAACACTATGGTGATGG + Intergenic
1013710947 6:112897746-112897768 GTGAAGACACAGTGAGATGATGG - Intergenic
1013999460 6:116348135-116348157 GTCAAGAAACAGGCTGGGCACGG + Intronic
1014689247 6:124542295-124542317 AGGAAGAGAAAGTCTGGTGATGG + Intronic
1014989930 6:128061986-128062008 ATGAAGGAACCTTCTGGTGAAGG - Intronic
1015562135 6:134527314-134527336 GTGAGGAAACTCTCTGATGAAGG - Intergenic
1016336223 6:143007783-143007805 ATGAGGAAACAGTGTGGGGAGGG + Intergenic
1016388534 6:143552215-143552237 GGGAAGAAAGAGTGTGGTGAGGG + Intronic
1016628803 6:146203287-146203309 GTCATGTAACAGTCTGATGAAGG + Intronic
1016844594 6:148558283-148558305 AAAAAGAAAAAGTCTGGTGAGGG - Intergenic
1017427293 6:154335533-154335555 GTGAAGATACAACCTGTTGAAGG + Intronic
1020679612 7:11220589-11220611 GTGAGGAAACAGTGAGGAGATGG - Intergenic
1022013517 7:26329318-26329340 GGGACAAAACAGTCTGGGGAAGG - Intronic
1023349560 7:39307107-39307129 CTGCAGAAACAGTCTTCTGAGGG - Intronic
1023891626 7:44396504-44396526 GTAAAGGAACAGTGTGGAGAGGG - Intronic
1024194504 7:47045825-47045847 GTGAGGAAACAGGCTTGAGAAGG - Intergenic
1024925979 7:54616541-54616563 GTCAAGAAACAGACTGCTGTTGG + Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1026467133 7:70663726-70663748 GGTAAGCAACTGTCTGGTGAAGG - Intronic
1028674185 7:93439815-93439837 GCAAAGAAACAGTCTGGAGAGGG + Intronic
1028730580 7:94143630-94143652 GAAAAGAAAAAGTCTGGTGTAGG - Intergenic
1030472031 7:109976707-109976729 GTGAACAAACATTGAGGTGAGGG - Intergenic
1030739132 7:113086876-113086898 GGGAAGAAAGTGTCTGGGGAAGG - Intronic
1030779355 7:113579707-113579729 GAGTAGCAGCAGTCTGGTGATGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032402346 7:131632537-131632559 GTAAAGCAACATTCTGGTGATGG - Intergenic
1032531875 7:132627934-132627956 GAGAAGAAATATTCTGGTGGAGG - Intronic
1034481781 7:151326822-151326844 GTGAGGAAGGACTCTGGTGAAGG + Intergenic
1035039349 7:155916282-155916304 GTGAAGGAACAGCCACGTGAAGG - Intergenic
1035403250 7:158582062-158582084 GTGTGGAAACAGTGTGTTGAAGG - Intronic
1035728523 8:1839478-1839500 GTGTGGAAACTGTCTGGTGTGGG + Intronic
1035728601 8:1839873-1839895 GTGTGGAAACTGTCTGGTGTGGG + Intronic
1035736148 8:1888910-1888932 GTGAGGAGACAGTGGGGTGAGGG + Intronic
1035736290 8:1889679-1889701 GTGAGGAAACAGTGGGGTGAAGG + Intronic
1037166201 8:15832011-15832033 ATGAAAAAACAGTATGTTGAAGG + Intergenic
1037513527 8:19607445-19607467 GTGAAGATACAGACAGCTGATGG + Intronic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1040401138 8:47051070-47051092 GTTAAGAAACAGTCAGGTCATGG - Intergenic
1045659340 8:104420554-104420576 GTGCAAAAACATTCTGATGATGG + Intronic
1045920859 8:107527472-107527494 TTCAAGAGACAGTCTGGAGATGG - Intergenic
1050035491 9:1431583-1431605 CTCAAGAAACAGACCGGTGATGG - Intergenic
1050109150 9:2196816-2196838 GTCAAGAAATAGACTGGAGATGG + Intergenic
1050349215 9:4723564-4723586 GTGTAGAAATAGTTTGGTAAGGG - Intronic
1050800603 9:9607960-9607982 GTGAGGAAACAGTCTGGATTTGG + Intronic
1050815192 9:9802135-9802157 GTGCAGACACAGTCTGGTCCAGG + Intronic
1051201675 9:14633553-14633575 GGCAGGATACAGTCTGGTGAGGG - Intronic
1052744319 9:32424901-32424923 GTGAGTAAACAGTGTGGTGAGGG - Intronic
1055623334 9:78148320-78148342 ATGAAGCAACAATCTGGGGAGGG - Intergenic
1056616071 9:88167116-88167138 GAGGAGAAACAGTCTGGAGAGGG + Intergenic
1056844667 9:90026767-90026789 TTGCAGAAATAGGCTGGTGAAGG - Intergenic
1056870035 9:90268633-90268655 GGGAAGAAACAGTCAAGAGAAGG + Intergenic
1056891961 9:90502663-90502685 GGGATGGAACAGTCAGGTGAGGG + Intergenic
1057797291 9:98167871-98167893 GAGATGAAACAGGCTGCTGATGG + Intronic
1058070341 9:100595326-100595348 GTGAAGAAGAAGTCAGGTAAGGG + Intergenic
1058951227 9:109905828-109905850 GAGAAGAAACAGTCAGGCCAGGG + Intronic
1059854594 9:118382700-118382722 GTGGAGGAACAGTCTAGGGAGGG + Intergenic
1062213573 9:135377432-135377454 GGGAAGAGACCCTCTGGTGAGGG - Intergenic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1186633049 X:11371204-11371226 TTGTAGAACCAATCTGGTGAGGG - Intronic
1187770461 X:22690250-22690272 GAGGAGAAACAGTGGGGTGAGGG + Intergenic
1187921113 X:24202846-24202868 TTTAAGACCCAGTCTGGTGATGG - Intronic
1190515651 X:51221324-51221346 GGGAATCAACAGACTGGTGAGGG - Intergenic
1193730962 X:85102352-85102374 GTGATGAAAATGTCTGGAGATGG + Intronic
1194665551 X:96673819-96673841 GTGAAGCAACAACATGGTGAGGG + Intergenic
1194665744 X:96675718-96675740 GTGAAGCAACAACATGGTGAGGG + Intergenic
1196069258 X:111501380-111501402 GTGCAGAAACTGTTTTGTGAAGG + Intergenic
1196571910 X:117275464-117275486 GTGAAGAAAGACACTGGTGAGGG - Intergenic
1198010370 X:132546432-132546454 GTGTTTAAACAGTCTGGTAATGG + Intergenic
1198216654 X:134561677-134561699 GCGAAGAAACATTGTGGTCAAGG - Intergenic
1199288448 X:146079555-146079577 GTGAAGATAGATTGTGGTGATGG + Intergenic
1199688274 X:150284108-150284130 GTGAAGATACAGCAAGGTGATGG - Intergenic
1200698463 Y:6381931-6381953 GTGAGGATAAAATCTGGTGAGGG - Intergenic
1200701040 Y:6402778-6402800 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200701365 Y:6405344-6405366 ATGAAGATACAATGTGGTGAGGG - Intergenic
1200701716 Y:6408113-6408135 GTGAGGATGCAATCTGGTGAAGG - Intergenic
1200701805 Y:6408857-6408879 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200702466 Y:6413811-6413833 GTGAGGATACAATCTGCTGAGGG - Intergenic
1200703873 Y:6425073-6425095 GTGAGGATACAATCTGGTGAAGG - Intergenic
1200705274 Y:6437271-6437293 GTGATGATACAATCTGGTGAGGG - Intergenic
1200705580 Y:6439725-6439747 GTGAGGATACATTCTGGTGAGGG - Intergenic
1200708077 Y:6459769-6459791 GTGAAGATACGATCTTGTGAGGG - Intergenic
1200708280 Y:6461669-6461691 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200709503 Y:6470838-6470860 GTGAGGATACAATCTTGTGAGGG - Intergenic
1200709746 Y:6472779-6472801 GTTAGGACACTGTCTGGTGAGGG - Intergenic
1200910279 Y:8525771-8525793 GTGAGGATACAATCTGGTGAGGG + Intergenic
1200912977 Y:8547394-8547416 GTGAGGATACAATTTGGTGAGGG + Intergenic
1200914104 Y:8556262-8556284 GTGAGGATACAACCTGGTGAGGG + Intergenic
1200915236 Y:8565603-8565625 GAGAGGATACAATCTGGTGAGGG + Intergenic
1200916921 Y:8579386-8579408 GTGAGGATACAATGTGGTGAAGG + Intergenic
1200917212 Y:8581889-8581911 GTGAAGATACAATCTGGTGAGGG + Intergenic
1200917528 Y:8584439-8584461 GTGAGGGCACAATCTGGTGAGGG + Intergenic
1200919863 Y:8603684-8603706 GTGAGGATACAGTCTGCTAAGGG + Intergenic
1200921404 Y:8616657-8616679 GTGAGAATACAATCTGGTGAGGG + Intergenic
1200921716 Y:8619147-8619169 GTGTGGATACAGTCTTGTGAGGG + Intergenic
1200922277 Y:8623851-8623873 GTGAGGATACAATCTGATGAGGG + Intergenic
1200922480 Y:8625612-8625634 GTGAAGATACAATCTGATGGGGG + Intergenic
1200924102 Y:8639062-8639084 GTTAGGATACAATCTGGTGAGGG + Intergenic
1200924655 Y:8643599-8643621 GTGAGGATTCATTCTGGTGAGGG + Intergenic
1200925995 Y:8655306-8655328 GTGAGGACACAATGTGGTGAGGG + Intergenic
1200926134 Y:8656626-8656648 GTAAGGATACAATCTGGTGAGGG + Intergenic
1200928096 Y:8672563-8672585 GTGAAGATATTATCTGGTGAGGG + Intergenic
1200930701 Y:8694414-8694436 GTGAAGATACAAACTGATGAAGG - Intergenic
1200931382 Y:8700098-8700120 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200931688 Y:8702663-8702685 GTGAGGATAAAGTCTGGTGAGGG - Intergenic
1200931972 Y:8705127-8705149 GTGAAGATACAGTCTGTTGAGGG - Intergenic
1200935418 Y:8734217-8734239 ATGAGGATACAATCTGGTGAGGG - Intergenic
1200936248 Y:8740909-8740931 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200936557 Y:8743431-8743453 TTGAAGATGCAATCTGGTGAGGG - Intergenic
1200937112 Y:8748017-8748039 GTGGGGATACAATCTGGTGAGGG - Intergenic
1200938288 Y:8757520-8757542 GAGAGGACACAATCTGGTGAGGG - Intergenic
1200939024 Y:8763397-8763419 GTGAGGATACAGTCTGCTGAGGG - Intergenic
1200939338 Y:8765866-8765888 GTAAGGATACAATCTGGTGAGGG - Intergenic
1200940205 Y:8772931-8772953 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200963707 Y:9017566-9017588 GTGAGGATACAATCTGGTGAAGG - Intergenic
1200984224 Y:9289127-9289149 GTGAGGATACAATCTGGTGAGGG - Intergenic
1200984846 Y:9293738-9293760 GTGAGCATACAATCTGGTGAGGG - Intergenic
1201024366 Y:9691929-9691951 GTTAGGACACTGTCTGGTGAGGG + Intergenic
1201024609 Y:9693870-9693892 GTGAGGATACAATCTTGTGAGGG + Intergenic
1201025832 Y:9703039-9703061 GTGAGGATACAATCTGGTGAGGG + Intergenic
1201026035 Y:9704939-9704961 GTGAAGATACGATCTTGTGAGGG + Intergenic
1201028531 Y:9724983-9725005 GTGAGGATACATTCTGGTGAGGG + Intergenic
1201028837 Y:9727437-9727459 GTGATGATACAATCTGGTGAGGG + Intergenic
1201030238 Y:9739634-9739656 GTGAGGATACAATCTGGTGAAGG + Intergenic
1201031645 Y:9750887-9750909 GTGAGGATACAATCTGCTGAGGG + Intergenic
1201032306 Y:9755841-9755863 GTGAGGATACAATCTGGTGAGGG + Intergenic
1201032395 Y:9756585-9756607 GTGAGGATGCAATCTGGTGAAGG + Intergenic
1201032746 Y:9759354-9759376 ATGAAGATACAATGTGGTGAGGG + Intergenic
1201033072 Y:9761920-9761942 GTGAGGATACAATCTGGTGAGGG + Intergenic
1201035651 Y:9782768-9782790 GTGAGGATAAAATCTGGTGAGGG + Intergenic
1201543299 Y:15132564-15132586 GAGAAGAAACATTCTGGTTTTGG - Intergenic
1202125593 Y:21566449-21566471 GTGAGCATACAATCTGGTGAGGG + Intergenic
1202126220 Y:21571110-21571132 GTGAGGATACAACCTGGTGAGGG + Intergenic
1202129802 Y:21599286-21599308 GTGAAGATACAGATTGGTGAAGG - Intergenic
1202130777 Y:21606663-21606685 GTGAGGATACAACCTGGTGAGGG - Intergenic
1202148790 Y:21826266-21826288 GTGTGGATACAATCTGGTGAGGG + Intergenic
1202149717 Y:21833717-21833739 GTGAAGATACAGACTGGTGAAGG + Intergenic
1202153415 Y:21862943-21862965 GTGAGCATACAATCTGGTGAGGG - Intergenic
1202175848 Y:22098235-22098257 GTGAAGATACAATCTGGTGAGGG - Intergenic
1202176498 Y:22103513-22103535 GTGAGGATACAATCTGGTGAAGG - Intergenic
1202177056 Y:22107529-22107551 GTGAGGATACAATCTGCTGAGGG - Intergenic
1202178344 Y:22118178-22118200 GTGAGGATACAATCTGGTGATGG - Intergenic
1202178960 Y:22123071-22123093 GTGAGGATACAATCTGGTGAGGG - Intergenic
1202179475 Y:22127253-22127275 GTAAAGATACAATCTTGTGAGGG - Intergenic
1202180328 Y:22134316-22134338 GTGAGGATACAATCTGGTGAGGG - Intergenic
1202181234 Y:22141662-22141684 GTGAGGATACAATCTGATGAGGG - Intergenic
1202181859 Y:22146617-22146639 GTGAGGATACAAGCTGGTGAGGG - Intergenic
1202182140 Y:22148721-22148743 TTGAAGATACAGTCTGGTAAGGG - Intergenic
1202182272 Y:22149762-22149784 GTGAGGATACAATCTGGAGAGGG - Intergenic
1202209088 Y:22436640-22436662 GTGAGGATACAATCTGGAGAGGG + Intergenic
1202209220 Y:22437681-22437703 TTGAAGATACAGTCTGGTAAGGG + Intergenic
1202209501 Y:22439785-22439807 GTGAGGATACAAGCTGGTGAGGG + Intergenic
1202210126 Y:22444738-22444760 GTGAGGATACAATCTGATGAGGG + Intergenic
1202211032 Y:22452083-22452105 GTGAGGATACAATCTGGTGAGGG + Intergenic
1202211886 Y:22459141-22459163 GTAAAGATACAATCTTGTGAGGG + Intergenic
1202212401 Y:22463323-22463345 GTGAGGATACAATCTGGTGAGGG + Intergenic
1202213017 Y:22468217-22468239 GTGAGGATACAATCTGGTGATGG + Intergenic
1202214305 Y:22478855-22478877 GTGAGGATACAATCTGCTGAGGG + Intergenic
1202214863 Y:22482871-22482893 GTGAGGATACAATCTGGTGAAGG + Intergenic
1202215513 Y:22488148-22488170 GTGAAGATACAATCTGGTGAGGG + Intergenic