ID: 1143446817

View in Genome Browser
Species Human (GRCh38)
Location 17:7014758-7014780
Sequence AGCGGCTCGGGCCCCCGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446817_1143446831 27 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1143446817_1143446821 -2 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446821 17:7014779-7014801 CTCAGTCTCCCTGCTCTCCGTGG 0: 1
1: 0
2: 1
3: 29
4: 226
1143446817_1143446826 18 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446817_1143446830 24 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446830 17:7014805-7014827 CGGCTCGCGTGTAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1143446817_1143446822 4 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446817_1143446827 21 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446817 Original CRISPR AGCGGCTCGGGCCCCCGCGC AGG (reversed) Exonic