ID: 1143446818

View in Genome Browser
Species Human (GRCh38)
Location 17:7014770-7014792
Sequence GCAGGGAGACTGAGCGGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446818_1143446832 28 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446818_1143446830 12 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446830 17:7014805-7014827 CGGCTCGCGTGTAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1143446818_1143446822 -8 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446818_1143446827 9 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446818_1143446826 6 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446818_1143446831 15 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446818 Original CRISPR GCAGGGAGACTGAGCGGCTC GGG (reversed) Exonic