ID: 1143446819

View in Genome Browser
Species Human (GRCh38)
Location 17:7014771-7014793
Sequence AGCAGGGAGACTGAGCGGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446819_1143446832 27 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446819_1143446831 14 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1143446819_1143446827 8 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446819_1143446830 11 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446830 17:7014805-7014827 CGGCTCGCGTGTAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1143446819_1143446822 -9 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446819_1143446826 5 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446819_1143446833 30 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446833 17:7014824-7014846 GCGGCGGCGTCTCCGTGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446819 Original CRISPR AGCAGGGAGACTGAGCGGCT CGG (reversed) Exonic