ID: 1143446820

View in Genome Browser
Species Human (GRCh38)
Location 17:7014776-7014798
Sequence CGGAGAGCAGGGAGACTGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 11, 3: 58, 4: 497}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446820_1143446831 9 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1143446820_1143446826 0 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446820_1143446827 3 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446820_1143446832 22 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446820_1143446833 25 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446833 17:7014824-7014846 GCGGCGGCGTCTCCGTGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1143446820_1143446830 6 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446830 17:7014805-7014827 CGGCTCGCGTGTAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446820 Original CRISPR CGGAGAGCAGGGAGACTGAG CGG (reversed) Exonic