ID: 1143446821

View in Genome Browser
Species Human (GRCh38)
Location 17:7014779-7014801
Sequence CTCAGTCTCCCTGCTCTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446817_1143446821 -2 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446821 17:7014779-7014801 CTCAGTCTCCCTGCTCTCCGTGG 0: 1
1: 0
2: 1
3: 29
4: 226
1143446812_1143446821 21 Left 1143446812 17:7014735-7014757 CCGCTGCGGGGAGGGCGGGACTT 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1143446821 17:7014779-7014801 CTCAGTCTCCCTGCTCTCCGTGG 0: 1
1: 0
2: 1
3: 29
4: 226
1143446809_1143446821 26 Left 1143446809 17:7014730-7014752 CCTATCCGCTGCGGGGAGGGCGG 0: 1
1: 0
2: 2
3: 10
4: 109
Right 1143446821 17:7014779-7014801 CTCAGTCTCCCTGCTCTCCGTGG 0: 1
1: 0
2: 1
3: 29
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446821 Original CRISPR CTCAGTCTCCCTGCTCTCCG TGG Exonic