ID: 1143446822

View in Genome Browser
Species Human (GRCh38)
Location 17:7014785-7014807
Sequence CTCCCTGCTCTCCGTGGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446819_1143446822 -9 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446818_1143446822 -8 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446812_1143446822 27 Left 1143446812 17:7014735-7014757 CCGCTGCGGGGAGGGCGGGACTT 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285
1143446817_1143446822 4 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG 0: 1
1: 0
2: 4
3: 29
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446822 Original CRISPR CTCCCTGCTCTCCGTGGTCC CGG Exonic