ID: 1143446824

View in Genome Browser
Species Human (GRCh38)
Location 17:7014788-7014810
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446824_1143446836 22 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446824_1143446832 10 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446824_1143446835 21 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446835 17:7014832-7014854 GTCTCCGTGAGGAGGCGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1143446824_1143446830 -6 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446830 17:7014805-7014827 CGGCTCGCGTGTAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1143446824_1143446834 20 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446834 17:7014831-7014853 CGTCTCCGTGAGGAGGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 61
1143446824_1143446833 13 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446833 17:7014824-7014846 GCGGCGGCGTCTCCGTGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1143446824_1143446831 -3 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1143446824_1143446827 -9 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446824 Original CRISPR GAGCCGGGACCACGGAGAGC AGG (reversed) Exonic