ID: 1143446825

View in Genome Browser
Species Human (GRCh38)
Location 17:7014796-7014818
Sequence CTACACGCGAGCCGGGACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446825_1143446836 14 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446825_1143446833 5 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446833 17:7014824-7014846 GCGGCGGCGTCTCCGTGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1143446825_1143446834 12 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446834 17:7014831-7014853 CGTCTCCGTGAGGAGGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 61
1143446825_1143446835 13 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446835 17:7014832-7014854 GTCTCCGTGAGGAGGCGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1143446825_1143446832 2 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446825 Original CRISPR CTACACGCGAGCCGGGACCA CGG (reversed) Exonic