ID: 1143446826

View in Genome Browser
Species Human (GRCh38)
Location 17:7014799-7014821
Sequence TGGTCCCGGCTCGCGTGTAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 789}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446817_1143446826 18 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446818_1143446826 6 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446820_1143446826 0 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789
1143446819_1143446826 5 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446826 17:7014799-7014821 TGGTCCCGGCTCGCGTGTAGCGG 0: 1
1: 0
2: 0
3: 16
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446826 Original CRISPR TGGTCCCGGCTCGCGTGTAG CGG Exonic