ID: 1143446827

View in Genome Browser
Species Human (GRCh38)
Location 17:7014802-7014824
Sequence TCCCGGCTCGCGTGTAGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446824_1143446827 -9 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446820_1143446827 3 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446819_1143446827 8 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446817_1143446827 21 Left 1143446817 17:7014758-7014780 CCTGCGCGGGGGCCCGAGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446823_1143446827 -8 Left 1143446823 17:7014787-7014809 CCCTGCTCTCCGTGGTCCCGGCT 0: 1
1: 0
2: 2
3: 12
4: 143
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1143446818_1143446827 9 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446827 17:7014802-7014824 TCCCGGCTCGCGTGTAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446827 Original CRISPR TCCCGGCTCGCGTGTAGCGG CGG Exonic