ID: 1143446829

View in Genome Browser
Species Human (GRCh38)
Location 17:7014804-7014826
Sequence CGCCGCCGCTACACGCGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446829_1143446836 6 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446829_1143446834 4 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446834 17:7014831-7014853 CGTCTCCGTGAGGAGGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 61
1143446829_1143446835 5 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446835 17:7014832-7014854 GTCTCCGTGAGGAGGCGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1143446829_1143446833 -3 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446833 17:7014824-7014846 GCGGCGGCGTCTCCGTGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1143446829_1143446832 -6 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446829_1143446839 30 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446839 17:7014857-7014879 CATGACGTCAGCGTCCACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446829 Original CRISPR CGCCGCCGCTACACGCGAGC CGG (reversed) Exonic