ID: 1143446832

View in Genome Browser
Species Human (GRCh38)
Location 17:7014821-7014843
Sequence GCGGCGGCGGCGTCTCCGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 319}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446829_1143446832 -6 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446828_1143446832 -5 Left 1143446828 17:7014803-7014825 CCCGGCTCGCGTGTAGCGGCGGC 0: 1
1: 0
2: 1
3: 10
4: 657
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446825_1143446832 2 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446823_1143446832 11 Left 1143446823 17:7014787-7014809 CCCTGCTCTCCGTGGTCCCGGCT 0: 1
1: 0
2: 2
3: 12
4: 143
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446824_1143446832 10 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446820_1143446832 22 Left 1143446820 17:7014776-7014798 CCGCTCAGTCTCCCTGCTCTCCG 0: 1
1: 0
2: 11
3: 58
4: 497
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446819_1143446832 27 Left 1143446819 17:7014771-7014793 CCGAGCCGCTCAGTCTCCCTGCT 0: 1
1: 1
2: 3
3: 16
4: 277
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319
1143446818_1143446832 28 Left 1143446818 17:7014770-7014792 CCCGAGCCGCTCAGTCTCCCTGC 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1143446832 17:7014821-7014843 GCGGCGGCGGCGTCTCCGTGAGG 0: 1
1: 0
2: 4
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446832 Original CRISPR GCGGCGGCGGCGTCTCCGTG AGG Exonic