ID: 1143446836

View in Genome Browser
Species Human (GRCh38)
Location 17:7014833-7014855
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446823_1143446836 23 Left 1143446823 17:7014787-7014809 CCCTGCTCTCCGTGGTCCCGGCT 0: 1
1: 0
2: 2
3: 12
4: 143
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446829_1143446836 6 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446828_1143446836 7 Left 1143446828 17:7014803-7014825 CCCGGCTCGCGTGTAGCGGCGGC 0: 1
1: 0
2: 1
3: 10
4: 657
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446824_1143446836 22 Left 1143446824 17:7014788-7014810 CCTGCTCTCCGTGGTCCCGGCTC 0: 1
1: 0
2: 3
3: 14
4: 207
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1143446825_1143446836 14 Left 1143446825 17:7014796-7014818 CCGTGGTCCCGGCTCGCGTGTAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1143446836 17:7014833-7014855 TCTCCGTGAGGAGGCGCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type