ID: 1143446839 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:7014857-7014879 |
| Sequence | CATGACGTCAGCGTCCACAA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 49 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 45} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143446829_1143446839 | 30 | Left | 1143446829 | 17:7014804-7014826 | CCGGCTCGCGTGTAGCGGCGGCG | 0: 1 1: 0 2: 0 3: 1 4: 27 |
||
| Right | 1143446839 | 17:7014857-7014879 | CATGACGTCAGCGTCCACAAAGG | 0: 1 1: 0 2: 0 3: 3 4: 45 |
||||
| 1143446837_1143446839 | -2 | Left | 1143446837 | 17:7014836-7014858 | CCGTGAGGAGGCGCGCGGGGCCA | 0: 1 1: 0 2: 0 3: 7 4: 125 |
||
| Right | 1143446839 | 17:7014857-7014879 | CATGACGTCAGCGTCCACAAAGG | 0: 1 1: 0 2: 0 3: 3 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143446839 | Original CRISPR | CATGACGTCAGCGTCCACAA AGG | Exonic | ||