ID: 1143446839

View in Genome Browser
Species Human (GRCh38)
Location 17:7014857-7014879
Sequence CATGACGTCAGCGTCCACAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143446829_1143446839 30 Left 1143446829 17:7014804-7014826 CCGGCTCGCGTGTAGCGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1143446839 17:7014857-7014879 CATGACGTCAGCGTCCACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 45
1143446837_1143446839 -2 Left 1143446837 17:7014836-7014858 CCGTGAGGAGGCGCGCGGGGCCA 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1143446839 17:7014857-7014879 CATGACGTCAGCGTCCACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143446839 Original CRISPR CATGACGTCAGCGTCCACAA AGG Exonic