ID: 1143447009

View in Genome Browser
Species Human (GRCh38)
Location 17:7015591-7015613
Sequence CTTGAGGCCCTGCGGGAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143447009_1143447023 26 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447023 17:7015640-7015662 CCTCTTTATGCATCCGTGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 77
1143447009_1143447014 -1 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447014 17:7015613-7015635 GAGCTTTCCGCCTCCCCTTACGG 0: 1
1: 0
2: 0
3: 4
4: 57
1143447009_1143447021 22 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447021 17:7015636-7015658 AGGACCTCTTTATGCATCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 55
1143447009_1143447015 2 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447015 17:7015616-7015638 CTTTCCGCCTCCCCTTACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
1143447009_1143447025 28 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447025 17:7015642-7015664 TCTTTATGCATCCGTGGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1143447009_1143447024 27 Left 1143447009 17:7015591-7015613 CCCGGTTCCCGCAGGGCCTCAAG 0: 1
1: 0
2: 1
3: 10
4: 141
Right 1143447024 17:7015641-7015663 CTCTTTATGCATCCGTGGAAGGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143447009 Original CRISPR CTTGAGGCCCTGCGGGAACC GGG (reversed) Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900592219 1:3465234-3465256 CTGGAGGCCCTCTGAGAACCAGG - Intronic
900661241 1:3785087-3785109 CTTGAGGTCCTGTGGGGGCCGGG + Exonic
902798630 1:18815740-18815762 CTTGAAGCCTTGGGGAAACCAGG + Intergenic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
906949571 1:50323423-50323445 CTAGAGGCCCTGGGGGAATCTGG - Intergenic
912640951 1:111346060-111346082 CTGGAGGCCTTGCGTGGACCGGG - Intergenic
913007404 1:114648359-114648381 TTTGAGGCCCTGCTGAAACTCGG - Intronic
916674513 1:167054459-167054481 CCTGCTGCCCTGCAGGAACCGGG - Exonic
917958524 1:180124721-180124743 CATGAGGCCCTGTTGGATCCTGG - Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
922789910 1:228305838-228305860 CTTGAGGGTCTAAGGGAACCTGG + Intronic
1065434406 10:25692371-25692393 CTGGAGGCCCTGCGAGAGTCTGG - Intergenic
1065523416 10:26593976-26593998 CTTGGGGCCCTGCGGGGCCGGGG - Intergenic
1066466022 10:35651044-35651066 CTAGAGGCCCTGCAGGCAACTGG - Intergenic
1067791295 10:49289693-49289715 GGTGGGGCCCTGCGGGAGCCAGG - Intergenic
1069638148 10:69937978-69938000 CTTCAGGCCCTGCTTGAGCCTGG + Intronic
1071905092 10:90164115-90164137 CTGGAGGCCCTGCCACAACCAGG + Intergenic
1074825298 10:117210431-117210453 CTTGAGGCCCTGCAGAAATTTGG + Intergenic
1076590384 10:131578380-131578402 GCAGAGGCTCTGCGGGAACCAGG - Intergenic
1076741588 10:132488360-132488382 CCTGAGGCTCTGCGGGGTCCGGG + Intergenic
1076875873 10:133215249-133215271 CTGAAGGCTCTGGGGGAACCAGG + Intronic
1077036605 11:498478-498500 TGTGAGACCCTGCTGGAACCTGG - Exonic
1077155665 11:1089806-1089828 TTTGGGGCCCTGTGGGACCCGGG + Intergenic
1078831725 11:14983708-14983730 CTTTAAGACCTGCAGGAACCTGG - Intronic
1079121230 11:17686506-17686528 CTTGAGGGCCTCTGGGAAGCAGG - Intergenic
1080534436 11:33207775-33207797 TTTGAAGCCCTGCAGGAAACTGG - Intergenic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1083635088 11:64116554-64116576 CTTGAGGTCCTGGGGGATGCCGG - Exonic
1085026128 11:73237684-73237706 CTGGAGACCCTGGGTGAACCAGG + Intergenic
1086427853 11:86704398-86704420 GTTGAGGCCCTATGGGAATCAGG + Intergenic
1088597741 11:111452500-111452522 CTTCAGGGCCTGGGGGATCCTGG - Intronic
1091207476 11:133831599-133831621 CCTGAGGACCTGCTGGACCCAGG - Intergenic
1095942977 12:47738402-47738424 CCAGAGGCCCAGCGGGGACCAGG + Intronic
1096417868 12:51429246-51429268 CTTGTGGCCCTGCCAGACCCAGG + Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097787788 12:63780070-63780092 CCTGAGGCCCCGCGGGGACCCGG - Exonic
1099890156 12:88580423-88580445 CTAGAAGCGCTGCGGGAAGCAGG - Exonic
1102813589 12:115844356-115844378 CTTGAGGCCTTGTGGGAAGAAGG - Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1121889595 14:97576787-97576809 ATGGAGGCCCTGCAGGACCCAGG + Intergenic
1122784788 14:104158658-104158680 CCTGAGGCCCTGCAGGCACCAGG + Intronic
1124999477 15:34755145-34755167 CTGGAGGCCCGGCGGGGAGCGGG + Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132390810 15:101436972-101436994 CTTGAGGGACTGTGGGATCCAGG - Intronic
1132829643 16:1921043-1921065 CTTAAGGCCCTGCGGGAACAGGG + Intergenic
1132989336 16:2785014-2785036 CTTGTGGCCCTGGGGGTAGCCGG + Exonic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1140037858 16:71384769-71384791 CTTCATGCCCTGCAAGAACCAGG - Exonic
1140476688 16:75242586-75242608 CTCCAGGCCCTGGGGGCACCTGG + Exonic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1142763586 17:2054479-2054501 CGTAGGGCCCTCCGGGAACCTGG - Intronic
1143026088 17:3942723-3942745 CTTGATGACCTGCGGGGTCCAGG + Exonic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1144778771 17:17797649-17797671 TTTCAGGCTCTGCGGGATCCAGG - Exonic
1146352383 17:32105432-32105454 CCTGAGGCCCTGAGTGGACCTGG - Intergenic
1148741960 17:49898091-49898113 GTTGTGGCCCTACGGGGACCCGG + Intergenic
1148911374 17:50944775-50944797 CGGGAGGCCCTGCAGGAAGCAGG + Intergenic
1149038271 17:52158516-52158538 CTGGACGCACTGCCGGAACCCGG - Exonic
1151338674 17:73455926-73455948 CTTGCGGCCGTCCCGGAACCAGG + Exonic
1152129696 17:78468586-78468608 CTTGAGGCCCTGCCGAAGACGGG + Intronic
1152147361 17:78576525-78576547 CTGAAAGCCCTGTGGGAACCTGG - Intronic
1160455330 18:78995243-78995265 TCTGAGGCCCGGCGGGGACCTGG - Exonic
1160559512 18:79747373-79747395 GCTGGGGCCCTGCGGGAACTGGG + Intronic
1160826235 19:1081810-1081832 GTAGATGCCCTGCGGGAGCCCGG - Exonic
1161010191 19:1956111-1956133 CGAGAGGCCCTGCGGGAGCCAGG + Intronic
1162810745 19:13163201-13163223 CTTGCGGCCCAGCGGGAAGGCGG + Intergenic
1165139536 19:33690461-33690483 ATTGAGGGCCTGTGGGCACCAGG + Intronic
1165812108 19:38617923-38617945 CCTGAGGCCCTGCTGGCCCCTGG - Exonic
1166357169 19:42234020-42234042 CTGGAGACCTTGGGGGAACCGGG - Intronic
1167850384 19:52196805-52196827 CTTGGGGACCTGAGGTAACCTGG - Intronic
926913013 2:17869002-17869024 GTTGAGGCACTGCCGGAACCTGG - Intergenic
927023578 2:19042635-19042657 ATTGAGGTCCTGAGGGAACCTGG - Intergenic
927463697 2:23321413-23321435 AGTGTGGCCCTTCGGGAACCAGG - Intergenic
927960342 2:27237393-27237415 CATGTGCACCTGCGGGAACCAGG + Exonic
928094359 2:28394529-28394551 CTTGAGGGTCTGGGGGTACCTGG + Intronic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
932575241 2:72959108-72959130 CTTGGGGCCCTGCCTGAAGCAGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
937032294 2:118750909-118750931 CTTCAGGCCATGCTGGATCCAGG + Intergenic
937207398 2:120245585-120245607 CCTGGCGCCCTGCAGGAACCAGG + Intronic
937983532 2:127628467-127628489 CTTCAGGCCCTCCAGGAACAGGG - Exonic
943671573 2:190667113-190667135 CTCCAGGCCCTCAGGGAACCTGG - Intronic
944927289 2:204478400-204478422 CTTGAGGCACTGCGAGAACTAGG - Intergenic
948907480 2:240986720-240986742 GCTGAGGCCCTGCAGGAACAGGG + Intronic
1170570059 20:17627532-17627554 ATTGAGGCCCTGCTGGAGGCGGG - Exonic
1171421221 20:25019022-25019044 CATGAGGCCATGCGGGCATCCGG - Intronic
1171960101 20:31487162-31487184 CTTAAGGCCTTGCAGAAACCAGG + Intergenic
1174140315 20:48408460-48408482 TGTCAGGCCCTGGGGGAACCAGG - Intergenic
1174349237 20:49955277-49955299 CTTGAGGCCCTGCAGCAAGGAGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176044563 20:63085618-63085640 CATGAGCCCATGAGGGAACCAGG - Intergenic
1179957728 21:44750536-44750558 CATGAGGCCCTGCAGCAGCCTGG + Intergenic
1180159772 21:45993834-45993856 CTTGTGGCCCGCCGGGAAGCTGG - Intronic
1183322699 22:37174852-37174874 CCTGTGGCCCTGAGGGAAGCTGG + Intronic
1183404878 22:37625531-37625553 CTTAAGGCCCTGCTGAAACTTGG - Intronic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
950393780 3:12718163-12718185 CTTGGGGGGCTGAGGGAACCCGG - Intergenic
950863357 3:16169848-16169870 CTTCAGGCACTGCGGACACCAGG + Intergenic
954581852 3:51707233-51707255 CTTGAGGGCCCGCAGGACCCTGG - Intronic
955946420 3:64198793-64198815 CTTCAGACCCGGCGGGACCCAGG + Exonic
961383389 3:126510218-126510240 CTGGAGGCCTTGTGGGAACATGG - Intronic
968454403 4:689615-689637 CTACAGCCCCTGCGGGAAGCAGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969531516 4:7733394-7733416 CTGGTGGCCCTGCGGGACACAGG + Exonic
969702423 4:8774750-8774772 CCTGAGGCCCTGCGGGGCACGGG + Intergenic
973228420 4:47813273-47813295 CTTGAGTCACTGCAGCAACCTGG + Intronic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985679337 5:1247745-1247767 CTTCAGGCCCTACTGGACCCAGG + Intergenic
989909942 5:49621608-49621630 CTTGAGGCCCTCGTGGAAACGGG - Intergenic
997740065 5:136245488-136245510 GATGAGGCCCTGCTGCAACCTGG + Intronic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
998296002 5:140969063-140969085 TTTGAGGCCATGCGGTATCCTGG - Exonic
999188449 5:149730189-149730211 CTAGCGGCCCTGCGGCAGCCGGG + Intergenic
1001638195 5:173227735-173227757 CTTGAGGGCCTGCAAGAAACTGG - Intergenic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003035627 6:2638410-2638432 ATTGAGGCCCAGCAGGAACATGG - Intergenic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1003234050 6:4280734-4280756 CTTGTGGCCCTGCAGAAACAAGG - Intergenic
1003571953 6:7261723-7261745 CTTCTGCCCCTGCGGAAACCGGG - Intergenic
1005826171 6:29632871-29632893 CTTGAGGCCCGGGGAGAGCCGGG - Exonic
1008565557 6:52764642-52764664 CTTAAGGCTCTGTGGGGACCCGG - Intergenic
1010098821 6:72078815-72078837 CTTGAGGCTCTGCAGTATCCTGG + Intronic
1017166672 6:151414395-151414417 CTTGAGGCAATGAGGGAAACTGG + Intronic
1018839285 6:167507142-167507164 CGGGAGGCTCTGCGGGACCCTGG - Intergenic
1018968050 6:168503977-168503999 CTTGAGGACCTGAGGAGACCGGG - Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019523294 7:1470020-1470042 CTTGAGGCCCGGCAGGGCCCAGG + Intergenic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1021605245 7:22403251-22403273 CATGAGGCCCAGCGTGAGCCTGG - Intergenic
1022202877 7:28134669-28134691 ATTGATGGCCTGCAGGAACCAGG - Intronic
1022624436 7:32020093-32020115 CTTGAGAGCCTGAGGGATCCCGG - Intronic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1024231546 7:47367496-47367518 CTTGAGGCCTGGGAGGAACCAGG - Intronic
1034897570 7:154887236-154887258 CCTGAGGCCCTGCGGTCAGCTGG - Intronic
1035534173 8:378538-378560 CTTGAGGCCCTGGAGGAAGCGGG - Intergenic
1038701965 8:29857262-29857284 CTTGAGGCCACCAGGGAACCTGG - Intergenic
1040060943 8:43102367-43102389 CTTGAGAACCTGAGGAAACCTGG + Intronic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1057198453 9:93127851-93127873 CCTGTGGCCCTGCGGCACCCCGG - Intronic
1060399278 9:123338744-123338766 GTTGAGGCCCTGAGAGAAGCAGG + Intergenic
1060408261 9:123383335-123383357 CTGCAGCCCCTGCTGGAACCGGG - Intronic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1062110929 9:134781782-134781804 CTTGAGGCCCTGGGAGCCCCGGG + Intronic
1186378611 X:9033794-9033816 CACGAGGCCCTCTGGGAACCAGG - Intronic
1197630540 X:128852847-128852869 CTTGAGGCCCTGCCTGAACATGG + Intergenic
1199692208 X:150317140-150317162 CTTGAGCCCCTGCGTGACCACGG - Intergenic
1200063051 X:153492080-153492102 CCTGAGGCCCTCAGGGATCCTGG - Intronic