ID: 1143448757

View in Genome Browser
Species Human (GRCh38)
Location 17:7023416-7023438
Sequence GTTCCACACCGCGGCGTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 15}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143448757_1143448765 15 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448765 17:7023454-7023476 AGCGCTGTGGGATCTGGAAGAGG 0: 1
1: 0
2: 0
3: 24
4: 336
1143448757_1143448762 3 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448762 17:7023442-7023464 CAACTGGCTCCAAGCGCTGTGGG 0: 1
1: 0
2: 1
3: 7
4: 63
1143448757_1143448768 28 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448768 17:7023467-7023489 CTGGAAGAGGCAAGGGAGCGAGG 0: 1
1: 0
2: 6
3: 47
4: 477
1143448757_1143448761 2 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448761 17:7023441-7023463 TCAACTGGCTCCAAGCGCTGTGG 0: 1
1: 0
2: 2
3: 9
4: 102
1143448757_1143448763 9 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448763 17:7023448-7023470 GCTCCAAGCGCTGTGGGATCTGG 0: 1
1: 0
2: 1
3: 10
4: 120
1143448757_1143448769 29 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448769 17:7023468-7023490 TGGAAGAGGCAAGGGAGCGAGGG 0: 1
1: 0
2: 2
3: 54
4: 668
1143448757_1143448766 20 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448766 17:7023459-7023481 TGTGGGATCTGGAAGAGGCAAGG 0: 1
1: 0
2: 5
3: 81
4: 537
1143448757_1143448767 21 Left 1143448757 17:7023416-7023438 CCAACGACGCCGCGGTGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1143448767 17:7023460-7023482 GTGGGATCTGGAAGAGGCAAGGG 0: 1
1: 0
2: 4
3: 48
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143448757 Original CRISPR GTTCCACACCGCGGCGTCGT TGG (reversed) Intronic
922775756 1:228213639-228213661 GATGTACACCGCGTCGTCGTCGG - Exonic
1063347255 10:5323610-5323632 TTTGCACACCGTGACGTCGTTGG + Intergenic
1106242036 13:27920359-27920381 GTGCGCCACCGCGGGGTCGTCGG - Exonic
1143448757 17:7023416-7023438 GTTCCACACCGCGGCGTCGTTGG - Intronic
1147162806 17:38577928-38577950 GTTCCACCCCGTGGCGTGCTGGG - Intronic
1152905941 17:82970997-82971019 GTTCCACAGGTCGGCGTCGTGGG + Intronic
1152960338 18:75948-75970 GAACCGCACGGCGGCGTCGTGGG - Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1181811326 22:25405316-25405338 GCTCCACAGCGCGGCGGCGGCGG + Intronic
956236929 3:67082757-67082779 GTTCCACACAGAGGGGTGGTCGG - Intergenic
957189405 3:76987332-76987354 GTTCCACACTGCCGTGTAGTGGG + Intronic
969526110 4:7704928-7704950 GTGCCACAGCGCGGGGTCGCAGG - Intronic
1010024821 6:71202945-71202967 GTTCCACACCTAGGCTTTGTGGG - Intergenic
1019028255 6:168990612-168990634 GCTCCACACAGGGGCGTTGTGGG + Intergenic
1026935818 7:74254671-74254693 GATCCGCTCCGCGGCGGCGTGGG + Intergenic
1028129319 7:87152086-87152108 GTTCCACACCGCGGCTCCCTCGG + Intergenic
1057691484 9:97290635-97290657 GTTCCATAACCCGGCCTCGTCGG + Intergenic
1062277161 9:135736521-135736543 GTTCCACTGCGCGGCGGCGTGGG + Intronic
1062737759 9:138147756-138147778 GAACCGCACGGCGGCGTCGTGGG + Intergenic