ID: 1143448774

View in Genome Browser
Species Human (GRCh38)
Location 17:7023507-7023529
Sequence ATGAACAAGAAGAATTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 519}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143448774 Original CRISPR ATGAACAAGAAGAATTAGGA GGG Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
903055767 1:20634918-20634940 ATGAGCAATAAGAACTGGGATGG - Intronic
904599383 1:31665289-31665311 ATGCACAGGAAGAATAAAGAAGG - Intronic
905078368 1:35294460-35294482 TTGAATTAGAAGAATTATGAAGG + Intronic
905115020 1:35631141-35631163 ATGAACAAGTAGCAACAGGAGGG + Intronic
905709914 1:40093355-40093377 ATTATCAAGAAGTAGTAGGAGGG + Intronic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
906971658 1:50520902-50520924 ATGATCTAGAAGAATTCAGAAGG - Intronic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
907211039 1:52822178-52822200 ATGAGAAAGAAAAATTATGAAGG + Exonic
908920904 1:69190526-69190548 ATAAACAAAAATAATTTGGAGGG + Intergenic
909087079 1:71180891-71180913 AAAAAAAAAAAGAATTAGGATGG + Intergenic
909966412 1:81916777-81916799 ATGTACAAGAATAATTAGAATGG - Intronic
910227864 1:84954919-84954941 GTGAACAAGAATAACTAAGAGGG + Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910891175 1:92021745-92021767 ATCAACTACAAGAATAAGGAGGG + Intergenic
911396999 1:97322254-97322276 ATAAATAAAAGGAATTAGGAAGG + Intronic
911625421 1:100118320-100118342 AAAAAAAAGAAGAATTAAGAAGG + Intronic
911660899 1:100500133-100500155 AGGAACAAGGACAAATAGGAAGG + Intronic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913200948 1:116494953-116494975 CTGAAAGAGAACAATTAGGAAGG + Intergenic
914244925 1:145878390-145878412 ATCAACAGCAAGAATGAGGATGG - Exonic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916571811 1:166034498-166034520 TTTAACAAGGAGAATTAGGTTGG - Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917308037 1:173647568-173647590 GTAAACAAGAAGAATATGGAAGG + Intronic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918202358 1:182279351-182279373 ATGAACTAGAAGGAACAGGAGGG + Intergenic
918462957 1:184795163-184795185 AGGAACAAGAAGAGATGGGAGGG - Exonic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920214898 1:204355121-204355143 TTGAACAAGGAGACTTGGGAGGG + Intronic
920224050 1:204425079-204425101 AGGAACAAGAAGAATCCAGAGGG + Intronic
920312181 1:205054941-205054963 ATGAGGAACAAGAATAAGGAAGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921799635 1:219387226-219387248 ATGAACATTAATAATTAGGTAGG - Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
923192551 1:231633852-231633874 ATGAAAAAGAAAAGTTAGGTAGG - Intronic
923594678 1:235351920-235351942 GTGATTAGGAAGAATTAGGATGG - Intergenic
923805387 1:237251902-237251924 AGGAAAAAGAATAATTAGAAGGG - Intronic
1062888018 10:1034103-1034125 TTTACCCAGAAGAATTAGGAGGG - Intergenic
1062972198 10:1656878-1656900 ATGAAGTAGAGGCATTAGGATGG + Intronic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1065826646 10:29578593-29578615 ATAAAGAAGAACATTTAGGAAGG - Intronic
1066411002 10:35169205-35169227 ATGAACAGGAAGAATCAATATGG - Intronic
1066586026 10:36936476-36936498 AAGAAAAAGAAAAATTAGTATGG + Intergenic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1067962448 10:50870295-50870317 ATGGACAAAAAGAAATTGGAAGG + Intronic
1068578809 10:58715082-58715104 ATTAAAAATAATAATTAGGAGGG + Intronic
1068589072 10:58834924-58834946 AAGAAAAAGAAAAATTAGGCAGG + Intergenic
1069142725 10:64847600-64847622 TTGAACGAGAATAATTTGGATGG + Intergenic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1069946636 10:71990873-71990895 ATGAACATTATGTATTAGGACGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070715078 10:78714090-78714112 AAGAACAAAAGGAATAAGGAAGG - Intergenic
1071031239 10:81184321-81184343 ATGAATAACAAAAATTAGCAAGG - Intergenic
1071166171 10:82810177-82810199 AAGCACACAAAGAATTAGGATGG - Intronic
1071232610 10:83606269-83606291 ATTAACAAGCACAATTAGGCTGG + Intergenic
1071280745 10:84100432-84100454 ATGTTCTAGAAAAATTAGGAAGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072969293 10:100003040-100003062 ATGAATAAGAAGTATAAGAATGG + Intronic
1072998781 10:100269968-100269990 ATGGATTAGAAGAATTAGGCGGG + Intergenic
1073308730 10:102524149-102524171 TTTAAAAAGAAGAATTAGGCAGG - Intronic
1073308747 10:102524299-102524321 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1074157499 10:110811668-110811690 GTTAAAAAAAAGAATTAGGAAGG - Intronic
1074193176 10:111155630-111155652 TTGCACAAGAAGAATTCTGATGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079366627 11:19815597-19815619 ATGAAGAAGAAGTTCTAGGATGG - Intronic
1079499832 11:21090581-21090603 TTGAGCAAGACAAATTAGGAGGG + Intronic
1080125038 11:28723143-28723165 ATGAACAAGTAAAATTTGGGGGG + Intergenic
1080449028 11:32363548-32363570 ATGAATAAGAAGGATTTGGGAGG + Intergenic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080889554 11:36397754-36397776 ATGAAGGAAAAGAATTAAGAAGG - Intronic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1082061759 11:47867124-47867146 AAAAAGAAGAAGAATTTGGAAGG - Intergenic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083002101 11:59301941-59301963 ATGAACAACAAAAATAATGAAGG - Intergenic
1083492515 11:63023371-63023393 ATGAACAAGATGAATTTGACAGG + Intergenic
1084577221 11:69997173-69997195 ATCCACAGGAAGAATAAGGATGG + Intergenic
1085653410 11:78289752-78289774 ATGAACACAAACAATGAGGAAGG + Intronic
1085658212 11:78336763-78336785 ATGAACAGGAATAAATAGCATGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1088807935 11:113368789-113368811 ATGACTAAGAAGTATTAGGTTGG + Intronic
1089413037 11:118263103-118263125 ATGAAAAAGAAGAAAAAGAAGGG + Intronic
1090833256 11:130434904-130434926 AGAAACAAGAATAAATAGGAAGG - Intergenic
1091094704 11:132809815-132809837 ATAAACAAGAAGAAGATGGAGGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091553338 12:1553548-1553570 ATGAAAAATAAGAATTAGACAGG + Intronic
1092216013 12:6683317-6683339 ATTAAAAATAATAATTAGGAGGG + Intronic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1092987138 12:13856625-13856647 AAGAACAAGAAGAGCAAGGAAGG - Intronic
1093122483 12:15288998-15289020 ATGAACAAAAAGAAATAGAGTGG + Intronic
1093185888 12:16019761-16019783 ATGATCAATAAGAATTACAAAGG - Intronic
1093364777 12:18280436-18280458 ATGATGAAAAAGAATTAGCAAGG + Intronic
1093504566 12:19850202-19850224 ATGAGCAGGAAGAATTGGGCTGG + Intergenic
1093738803 12:22656832-22656854 ATGAAACAGATGATTTAGGAGGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094246860 12:28308120-28308142 ATAAATAAGAAAATTTAGGAAGG - Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1094554071 12:31481101-31481123 ATGAATAATGAGTATTAGGATGG - Intronic
1094598541 12:31887758-31887780 ATGAACACTAAGCCTTAGGATGG + Intergenic
1095993962 12:48062436-48062458 GTGACCAAGAATAATAAGGAAGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096883701 12:54695573-54695595 AAGAATAACAGGAATTAGGAAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097358507 12:58630551-58630573 ATGAACATGAAGAATTAAGTAGG - Intronic
1097370649 12:58775793-58775815 ATGAACAAGAAGATTTTGAGGGG - Intronic
1097496465 12:60343837-60343859 CTGAACAAGAAAAATAAAGAAGG - Intergenic
1097862300 12:64530080-64530102 GTGAACAAGAAGGATTACAAAGG - Intergenic
1098437390 12:70482263-70482285 ATGAAGAGCAAGAATAAGGATGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098528707 12:71516091-71516113 ATAAACAAGAAGAAAAAGGGAGG + Intronic
1099768898 12:87026989-87027011 ATGAAAAATAAGTATTAAGAAGG - Intergenic
1100041678 12:90327080-90327102 ATTACCAAGAAGAATGCGGAAGG - Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100825057 12:98467325-98467347 ATGGACAAGAAGGCTTTGGAGGG + Intergenic
1101656661 12:106727497-106727519 ATGAAATAGAAGAATTAGAAAGG + Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103473112 12:121197851-121197873 ATGAACCAGAAAAATTTGCAAGG + Intergenic
1103691258 12:122775907-122775929 ATAAACAAGAATAATGAGGTTGG - Intronic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1105984370 13:25550716-25550738 AGGACCAAGAAGAGTCAGGAAGG - Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109897202 13:68708757-68708779 ATGACCTAGAAGAAACAGGAAGG - Intergenic
1109947578 13:69457639-69457661 AAGAACAAGAAGTATAAGGGAGG + Intergenic
1110764468 13:79266983-79267005 AGGGATAAGAAGAATTAGAAAGG - Intergenic
1111090695 13:83442275-83442297 TTGAACAAGATGAATTAGTCTGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1111349100 13:87002545-87002567 ATAAACATGAAGAATTATGATGG + Intergenic
1112504220 13:99965932-99965954 ATTAGGAAGAAGAATTAGGCTGG - Intronic
1112919688 13:104596693-104596715 AGGAAAAAGAAGAGTTTGGAAGG - Intergenic
1114624369 14:24119192-24119214 ATGGACGAGAAGTACTAGGAGGG + Exonic
1115302886 14:31903995-31904017 ATAAACAAGAAAAACAAGGAAGG - Intergenic
1115748993 14:36469057-36469079 AAAAAGAAGAATAATTAGGAAGG + Intergenic
1116006129 14:39293365-39293387 CTGAACAAGATGAATTGGTAAGG + Exonic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116103518 14:40470508-40470530 ATGACCAGGAAAAATTAGGCAGG - Intergenic
1116307518 14:43277360-43277382 AAGACCAAGAAGAATAAGGCAGG + Intergenic
1118910133 14:70055192-70055214 GTGAACAAGATGAATTAGGATGG - Intronic
1119777112 14:77256347-77256369 ATGATCAAGAACAATTAGGTGGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120110057 14:80543484-80543506 CTGAACAAAAAGTATTAAGAGGG + Intronic
1120888109 14:89467765-89467787 AGGAAGAAGAAGAATTAGCTGGG - Intronic
1122021484 14:98841470-98841492 AAGAGCAAAAAGAATTGGGAGGG + Intergenic
1123051185 14:105544381-105544403 ATGACACAGAAGAGTTAGGAGGG - Intergenic
1123111432 14:105869032-105869054 AAGAACAAGAAAACTTAAGATGG - Intergenic
1123685331 15:22792960-22792982 AAGAACAAAAAGAATTGGGTTGG + Intronic
1124223199 15:27867307-27867329 GTGAAAAAAAAGAATTAGCAAGG + Intronic
1124447266 15:29748553-29748575 AAAAAAAAAAAGAATTAGGAAGG - Intronic
1124453295 15:29818393-29818415 TTGAAAAACAAGAATTAGGGTGG - Intronic
1125840687 15:42798596-42798618 ATGAACACAAAGAAGTTGGAAGG + Intronic
1127062290 15:55199106-55199128 ATGAATAAGAAGGACAAGGAAGG - Intergenic
1127127623 15:55827669-55827691 ATGAAGAAAATGAATTATGATGG + Exonic
1127246296 15:57179051-57179073 GTGAAAAAGAAAAATTAAGATGG + Intronic
1127624340 15:60765382-60765404 AGGAACAAGTAGAATTAGGTAGG - Intronic
1130532802 15:84760298-84760320 ATGAACAAGAAGGAAGAGAAAGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131910460 15:97194222-97194244 ATGAATAAGAATAATGATGAGGG + Intergenic
1131969986 15:97882090-97882112 ATGAACCAGAAGAATCAAAAAGG - Intergenic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133068286 16:3226349-3226371 ATTAAAAAGAATAATTAGGTCGG - Intronic
1133592056 16:7254810-7254832 ATGAACAAGAAGAAAAAGACTGG + Intronic
1133644549 16:7751860-7751882 ATAAACAAGAAAACTGAGGAAGG + Intergenic
1133834496 16:9354816-9354838 ATGAAAAAGAGGAATTACCAGGG - Intergenic
1134187349 16:12095024-12095046 ATGAAGATGATGATTTAGGAAGG + Intronic
1134454473 16:14384357-14384379 ATAAAAAAGAAAAATTAAGAAGG + Intergenic
1135305199 16:21361928-21361950 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1136078411 16:27833435-27833457 TTGAAAAAGAAGAATAAGGCAGG - Intronic
1136301943 16:29341093-29341115 ATAAACAAGAAGAAGTATGAGGG - Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138211500 16:55166900-55166922 ATGGACAAAAAGAAATAGCAAGG + Intergenic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1138992672 16:62410157-62410179 GTGACCAAGAAGAATGAGGTAGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1140267164 16:73430596-73430618 AGGAACAAGAAGCATTGGGTTGG + Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1144253764 17:13445140-13445162 ATGAATCAGATGAACTAGGAGGG - Intergenic
1145295428 17:21588544-21588566 ATGATCAAGAACAATGAGTAAGG + Intergenic
1145762596 17:27434530-27434552 ATGAAAAAAAAAAATTAGCAGGG + Intergenic
1146136353 17:30324229-30324251 ATGAGCAAGAAATATGAGGAGGG + Intronic
1146564595 17:33901476-33901498 ATGAAAAAGAGGAATAAGGGAGG - Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147621593 17:41871726-41871748 GTGAACAAGATGAAGAAGGAAGG - Exonic
1148281213 17:46348932-46348954 AGGAATAACAAGATTTAGGAGGG + Intronic
1148303441 17:46566867-46566889 AGGAATAACAAGATTTAGGAGGG + Intronic
1148891883 17:50813560-50813582 AGGTAGTAGAAGAATTAGGAAGG + Intergenic
1149153901 17:53603248-53603270 ATGATCAAAAAGAATAAAGAAGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1150319444 17:64199888-64199910 ATGCACAAGAAGAGAAAGGAAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1152774469 17:82191962-82191984 ATAAAAAAGTAGAATTAGGTTGG - Intronic
1203192519 17_KI270729v1_random:202981-203003 ATGACCAAGAAGATTTGAGAAGG - Intergenic
1203201884 17_KI270730v1_random:2416-2438 ATGACCAAGAAGATTTGAGAAGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG + Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156454372 18:37284713-37284735 ATCAACAAGAAGAATCACAATGG + Intronic
1156672656 18:39489429-39489451 AAGAAAAGGAAGATTTAGGATGG - Intergenic
1156768086 18:40683929-40683951 AATAAAAAGAAGAACTAGGAAGG - Intergenic
1156987153 18:43361763-43361785 AAAAAGAAGAAGAATAAGGAGGG + Intergenic
1158873107 18:61708002-61708024 GTGATCAAGAAGCACTAGGATGG + Intergenic
1158875054 18:61725556-61725578 ATGAACAAGAAGACCAAGGATGG - Intergenic
1159506201 18:69339890-69339912 TAGAAAAAGAAGAATTAGAATGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159851321 18:73530075-73530097 ATGGACAAAAAGAATAAGAAAGG + Intergenic
1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG + Intronic
1161916142 19:7229721-7229743 ATGAAAAAGAAGAATTACTCTGG + Intronic
1162448816 19:10741949-10741971 AAGAACAAGAACAAAAAGGAAGG - Intronic
1162613553 19:11776323-11776345 ATAAACAAATAGAATAAGGAAGG - Intronic
1163381898 19:16974664-16974686 ATGAAAAAGAAAAGTTTGGAAGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164204025 19:23043054-23043076 AAGAAATGGAAGAATTAGGATGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1165337214 19:35179530-35179552 ATAGACAACAAGAATTAGCATGG + Intergenic
1165395896 19:35563442-35563464 ATGAGCAAGAAGAAGAAGGCGGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
926481526 2:13402796-13402818 ATGATCAAGTGGAATTAAGATGG + Intergenic
926930265 2:18030856-18030878 ATGAACAAAAAGAATAAAGCAGG + Intronic
927121894 2:19972470-19972492 ATAAAGAACAAGAATTAAGAAGG + Intronic
927207804 2:20621083-20621105 ATGAACAGGAAGAACCAGGCAGG + Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927658113 2:24969049-24969071 ATGAACAGAAAGGATAAGGATGG - Intronic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927840630 2:26440705-26440727 AGGAACAAGATGAATGGGGACGG - Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930278181 2:49338310-49338332 TAGAACAAGAAGAATCAGTAGGG + Intergenic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931682319 2:64761221-64761243 AAGAAAAAGAAAAATTAGCAGGG + Intergenic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
932415900 2:71573795-71573817 AAGAAAAAGAAAAATCAGGAGGG - Intronic
933529762 2:83492467-83492489 TAGAACAAGAAAAATTAGCATGG + Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
935428986 2:102952892-102952914 ATAAACAAGAAAATTTAGTAAGG - Intergenic
937534437 2:122868354-122868376 ATGACATAGAAGATTTAGGATGG + Intergenic
938617647 2:133016038-133016060 ATGAACAAAAAAAATTAGAAAGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939230694 2:139422325-139422347 ATCAACAAAAAGTATTAGGTTGG - Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939967324 2:148623286-148623308 ATGAAAGAGAAGATTTATGATGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940716123 2:157225981-157226003 AGGAACTACAAGAATTGGGAAGG - Intergenic
940935695 2:159491909-159491931 AATAAAAAGAAGAATTAGGATGG - Intronic
941178622 2:162232075-162232097 AAGGACAGGAAGTATTAGGATGG + Intronic
941270591 2:163422532-163422554 ATAAAGAAGAAGACATAGGAAGG + Intergenic
941499010 2:166245431-166245453 ATGAACAAGAAGGACCAAGAGGG + Intronic
941677132 2:168355855-168355877 AAGAAGAAAAAGAATTTGGAAGG - Intergenic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942381614 2:175397488-175397510 CTGAACAAGAAATATTTGGAAGG - Intergenic
942448601 2:176094444-176094466 AAGCACAAGAAAAATTAGGCTGG - Intronic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942619722 2:177834146-177834168 ATGACCAGGAAGAATTAGGCAGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
943698796 2:190966736-190966758 ATTAGCAAGTAAAATTAGGAAGG - Intronic
943804327 2:192103524-192103546 AAGAACAAGATAAAGTAGGAAGG - Intronic
944745959 2:202656935-202656957 AAGAACAAGAAAAATTACCAGGG - Intronic
945535398 2:211011411-211011433 ATGAAGCAGAAGAATTCAGAAGG + Intergenic
945656412 2:212629422-212629444 ATGAACAAGAAGGAAAAGAAGGG - Intergenic
947297758 2:228651455-228651477 ATGAAAAAAAAGAGTTAGCATGG + Intergenic
947358836 2:229325732-229325754 AGGAAAAAGAAAAATTAGAAAGG + Intergenic
1169384484 20:5136639-5136661 AAGAACAAGATGGATTAGGAGGG - Intronic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170740920 20:19055481-19055503 ATGAACAAGAAGAACAAAGTTGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174361020 20:50029096-50029118 ATGAACTAAAGGAATTGGGAGGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1177485613 21:21751508-21751530 ATGAAGGAGAAAAATTAGGCAGG + Intergenic
1177788477 21:25696438-25696460 ATGAACAACATGAAAAAGGAAGG - Intronic
1177936781 21:27358109-27358131 TTGAACAAGATGAATTTGAATGG + Intergenic
1178627573 21:34231079-34231101 ATGCAAAAGAAGAATTAAGTGGG - Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179797299 21:43792664-43792686 CTACACAGGAAGAATTAGGAAGG + Exonic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181419468 22:22787870-22787892 AAGAACAAGAAGATTAAGGTAGG - Intronic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182888361 22:33795406-33795428 ATGTATAAGAAGTTTTAGGAGGG + Intronic
949243508 3:1898326-1898348 GTGAACAAGATGAATTAAAATGG + Intergenic
950300050 3:11868965-11868987 ATGAACAGAAAAAATTTGGAAGG - Intergenic
951073469 3:18361028-18361050 CAGAACAAGATGAATTAGCAGGG + Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952671259 3:35972308-35972330 ATGAACAAAAAAAAGTAGTAAGG - Intergenic
953391192 3:42534851-42534873 ATGACCAGGAAGTATGAGGATGG - Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954003379 3:47575093-47575115 ACGAACAAGAACAAGAAGGATGG + Intronic
955276035 3:57548021-57548043 ACGAACAACAAGATTTAGAATGG + Intergenic
955898055 3:63721868-63721890 ATGGACAGGAAGAATCAGTATGG + Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958044331 3:88265607-88265629 ATCAACAAAAAGAACAAGGAAGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959369966 3:105511047-105511069 AAGAACAAGATAATTTAGGAAGG - Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
960529136 3:118743711-118743733 AAGAAAAAGAAAAATTAGAAAGG + Intergenic
960781065 3:121317980-121318002 ATAAATAAGAAGAATTAGAAGGG - Intronic
963138255 3:141927559-141927581 ATACACAAGAAGAATTGAGATGG + Intergenic
963292556 3:143507051-143507073 ATGCACAAGATGAATAAGGAAGG - Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963441624 3:145346933-145346955 ATGAACAAGGTTAATTTGGAAGG + Intergenic
963928310 3:150975395-150975417 TTCAACAATAAAAATTAGGAAGG - Intergenic
964337362 3:155669810-155669832 TTCAACAAGTAGAAATAGGAAGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966316573 3:178653399-178653421 ATAAAGAATAAGAATTAGAAGGG - Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968560107 4:1275485-1275507 TTGAAAAAGAAGAATAAGGCTGG + Intergenic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
970010264 4:11450839-11450861 ATGAACAAGGAGAACTGAGAAGG - Intergenic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970458815 4:16252473-16252495 ATACACAAGAAAAATTTGGAGGG - Intergenic
970486946 4:16534328-16534350 ATGAACAAGATGGCTTAGTAGGG + Intronic
970684047 4:18545158-18545180 ATGAAAAAGAAGTATTACGTTGG + Intergenic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973143043 4:46792712-46792734 GAGAATCAGAAGAATTAGGATGG - Intronic
973238834 4:47934976-47934998 AAGAACAAGAAGAAAAAGAAAGG + Intronic
973267819 4:48229092-48229114 ATGAACAAAATGAATTAGCATGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
977423339 4:96831741-96831763 AGGAACAAGAGGAATTTTGAAGG - Intergenic
977710153 4:100115336-100115358 AAGAACTAGAAAAATTAGGAGGG - Intergenic
978234642 4:106443740-106443762 ATGTATAGGAAGAATTAGGCTGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979173485 4:117631920-117631942 TTGAGCAAGAAGAATAAAGATGG + Intergenic
979763867 4:124440873-124440895 ATGAGCAAAAAGAATAAGGCTGG - Intergenic
980086526 4:128396361-128396383 TTGGACAAGATGAATAAGGAAGG - Intergenic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981215739 4:142164892-142164914 AAGAAAGAGAAGCATTAGGATGG - Intronic
982083249 4:151810299-151810321 ATGAACAAGAAGGGGTAGCATGG + Intergenic
982719942 4:158849020-158849042 GAGATCAAGAAGAATCAGGATGG - Intronic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984111911 4:175627400-175627422 ATGAGCAAGGAGATTTAGAAAGG + Intergenic
984709107 4:182870051-182870073 AAGAAAAAGAGGAAATAGGAGGG - Intergenic
986534971 5:8777330-8777352 AAGAACAAGAACATTTAGGCAGG + Intergenic
986989111 5:13531207-13531229 AAAAAAAAGAAGAAGTAGGAAGG - Intergenic
987179374 5:15350689-15350711 ATGCACAAGAATAATTTGCATGG - Intergenic
987389982 5:17366664-17366686 AAAAAAAAGAAAAATTAGGAAGG + Intergenic
988019449 5:25605305-25605327 AGGACCAAGAAGAATAAGGCAGG + Intergenic
988275414 5:29075680-29075702 ATTAACAGGAAGATTTAAGAAGG + Intergenic
988403867 5:30799023-30799045 AAGAAAAAGAATCATTAGGAAGG + Intergenic
988491007 5:31705722-31705744 ATGAACAAGAAGAATAGGATAGG + Intronic
988783799 5:34547475-34547497 ATGACCAAGAAAACTAAGGAGGG + Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
988965858 5:36417226-36417248 ATGAACAAGAAAATTTCAGATGG + Intergenic
989092478 5:37748022-37748044 ATGAATAGGAAGAATCAGTATGG + Intronic
989740390 5:44764033-44764055 ATAAACAAGAAAACTTAGGAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990377107 5:55181947-55181969 ATGAACAAGATGAACAAGGGAGG - Intergenic
990473535 5:56140229-56140251 ATGAACAAGAAGTCTAAAGAAGG + Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
993814966 5:92532040-92532062 ATGAAAAAGAATACTTATGAAGG + Intergenic
993909944 5:93669122-93669144 AAGAACAACTAGAATTAGGAAGG - Intronic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
994243437 5:97450617-97450639 GTGAAAAAGAAGAAGTGGGAAGG - Intergenic
994473557 5:100239376-100239398 TTGAACAAAGAAAATTAGGAGGG - Intergenic
994635562 5:102341239-102341261 ATGAACATGAAGTATCAGAAAGG + Intergenic
994686197 5:102955743-102955765 ATGAACATGAGAAAGTAGGAAGG - Intronic
995488508 5:112664159-112664181 ATGAAAAAGAACAAATACGAAGG - Intergenic
995651419 5:114373235-114373257 AAGATCATGTAGAATTAGGAAGG - Intronic
996157017 5:120114736-120114758 ATGAAGATGAAGAATTTGTAGGG + Intergenic
996452675 5:123644140-123644162 ATGAATAATAAGTATTAGCAAGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996522067 5:124438300-124438322 ATAAACAAGAAAAAGCAGGAAGG + Intergenic
996570792 5:124930526-124930548 TTAAACAAGAAGGAATAGGATGG - Intergenic
997142773 5:131400416-131400438 TTAAACAAGAAGGATTAGGGGGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998899620 5:146839093-146839115 ATGAAGAAGAGTATTTAGGAAGG - Intronic
998921842 5:147077718-147077740 TTTAAAAAGAAGAATTAGGTTGG - Intronic
999135159 5:149313836-149313858 ATGAAGATGAAAAATTAGCAGGG + Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000000220 5:157131314-157131336 AAAAACTAAAAGAATTAGGATGG + Intronic
1001897571 5:175394525-175394547 ATGAACAAAGAGGATAAGGAAGG - Intergenic
1002019795 5:176355963-176355985 ATAAAAAAAAAGGATTAGGACGG - Intronic
1002609995 5:180410892-180410914 ATGAACAAGTGGAATTTGAAAGG + Intergenic
1002829864 6:809924-809946 ATAAAGTAGAACAATTAGGATGG + Intergenic
1003433107 6:6058375-6058397 TTGAACATGAAGGATTGGGAAGG - Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004702603 6:18093117-18093139 AAAAAAAAAAAGAATTAGGAGGG - Intergenic
1005254033 6:23980910-23980932 ATGAACAAAAAGCATAGGGAAGG + Intergenic
1005369516 6:25116549-25116571 TTGAAAAAGAAAAATTAAGAAGG - Intergenic
1005746194 6:28839905-28839927 ATAAACCAAAAGAATGAGGAAGG + Intergenic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006415712 6:33902739-33902761 ATCACCAAGAGGAATTAGAATGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007529542 6:42529580-42529602 TTGAAAAAGAACAATTATGAAGG - Intergenic
1008175081 6:48258790-48258812 AGGAACGTGAAGAGTTAGGAGGG + Intergenic
1009675541 6:66814971-66814993 AGTAACAAGAAGAATCAGGCAGG - Intergenic
1009761901 6:68017733-68017755 ATTAACAAGAAGAAATATAAAGG + Intergenic
1009768943 6:68120274-68120296 ATGAACAAAAAAAATTAGTCAGG + Intergenic
1010485344 6:76405217-76405239 ATGAAAAAGAAGTGTTGGGAAGG - Intergenic
1010761496 6:79728435-79728457 TTGATCAAGATGGATTAGGAAGG + Intergenic
1011716008 6:90105755-90105777 ATGAACAAGAAGAAAAGTGAAGG + Intronic
1011924175 6:92621823-92621845 ATGAGACAGAAGAATTAGAAGGG + Intergenic
1012390213 6:98729669-98729691 ATGAGCAAGGAGGATTGGGAAGG + Intergenic
1012584540 6:100906452-100906474 ATGAAATCGAAGTATTAGGAGGG + Intergenic
1012705970 6:102530938-102530960 ATGAACTGGAAGAATTAACATGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013797628 6:113904811-113904833 AAGAACAAGAGGAATTAGTGTGG + Intergenic
1014301211 6:119683857-119683879 ATTAGCAAGAATAATTAGCATGG - Intergenic
1014977620 6:127908335-127908357 AGGAACTTCAAGAATTAGGAAGG + Intronic
1015437951 6:133211880-133211902 ATAGACAAGAAGAAATAGAATGG + Intergenic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015560622 6:134511329-134511351 ATGAGGAAGATGAATTAGAATGG - Intergenic
1015725840 6:136298493-136298515 ATAAACAAGAAGAATAAGGATGG + Intergenic
1017064439 6:150516483-150516505 ATGAACAACAAGAATAATAAAGG + Intergenic
1017379052 6:153806185-153806207 ATGAAAAGGATAAATTAGGAGGG + Intergenic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1018255746 6:161917096-161917118 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1018638639 6:165886571-165886593 TTGAACAAGAAGAAATCAGAAGG + Intronic
1018756668 6:166855503-166855525 AAGAAGAAGAAGAATAAGAAGGG + Intronic
1019272340 7:157214-157236 AGGAAAAAGAAGAATCAGAAAGG - Intergenic
1019979403 7:4610148-4610170 AAGAAGAAGAAGAATTAGCTGGG + Intergenic
1020547780 7:9555138-9555160 ATATACAAGAAGAATTAGCAAGG + Intergenic
1020561031 7:9728685-9728707 ATGAAAAAGAAAAGTTTGGAAGG - Intergenic
1022350889 7:29565450-29565472 AGTAAAAGGAAGAATTAGGATGG + Intronic
1023019532 7:35998153-35998175 ATGAACAAGAGTATTTAGCAAGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023569596 7:41558268-41558290 GTGATCTAGAAGCATTAGGATGG - Intergenic
1023789449 7:43741381-43741403 ATGAAAAAGAAAAATTGTGAGGG + Intergenic
1023845745 7:44119180-44119202 ATGAACAAGAACACATGGGAGGG + Intronic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026900875 7:74036800-74036822 AAAAAAAAGAAGAAATAGGAAGG - Intronic
1027972526 7:85103619-85103641 GTGAAAAAGAAGAATTATGGTGG - Intronic
1028344865 7:89767265-89767287 ATGATTAAGAATAATAAGGAAGG + Intergenic
1028555429 7:92118453-92118475 ATCAAAAAGAAGAAATAGGTGGG - Intronic
1028628278 7:92903030-92903052 ATGAACTACAAGAATCAGCATGG + Intergenic
1028651214 7:93152380-93152402 ATGAGCATGAAGTATCAGGAAGG - Intergenic
1029009740 7:97246453-97246475 ATGAACAAAAAGAAAAAGGCCGG + Intergenic
1030828280 7:114188282-114188304 ATGAAGAAGAAAAACTAGGCAGG - Intronic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031144924 7:117987046-117987068 ATTAGCAAGATGAATTAGGGAGG + Intergenic
1031686548 7:124737028-124737050 ATGAATTAGGTGAATTAGGATGG - Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032545452 7:132737938-132737960 ATGTACACAAAGAAATAGGAGGG - Intergenic
1032682461 7:134199277-134199299 ATGAACAAGGAAAAATATGAGGG + Exonic
1033093029 7:138404345-138404367 ATGAACAAGAGGAAGAAGGTGGG - Intergenic
1036534289 8:9630355-9630377 ATGTACAAGAAATATTAGGGAGG + Intronic
1036573330 8:10001267-10001289 TGGAACAAAAAGAATAAGGAAGG + Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1039364100 8:36912467-36912489 ATGAACAGCCAGACTTAGGAGGG + Intronic
1039701081 8:39962566-39962588 ATGACCAGGAAGAATTAGGCAGG + Intronic
1041420059 8:57657164-57657186 TTGAAAAAGAAGAATTAAGTTGG - Intergenic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043096924 8:75987075-75987097 ATGAACAAGAAGGATTATTGTGG + Intergenic
1043157826 8:76807408-76807430 CTGAACAAGCAGAATTAGATTGG + Intronic
1043179336 8:77066262-77066284 ATGAACAATAGGTATAAGGATGG - Intergenic
1043315811 8:78920294-78920316 AGGAGAAAGAAGAACTAGGAAGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043829108 8:84966435-84966457 ATTAACAAAAAGGTTTAGGAAGG + Intergenic
1044245450 8:89939206-89939228 ATGAAAAAGAAAAATAGGGAGGG + Intronic
1044414279 8:91918253-91918275 ATGAACATGAAGATTTGGAATGG - Intergenic
1044439927 8:92210947-92210969 CTGAACAAGAAGAAGAAGAATGG - Intergenic
1044883915 8:96755247-96755269 AGGAACAAGAAGACTAAGGCAGG - Intronic
1044894285 8:96873247-96873269 ATGAATCATAAAAATTAGGAAGG + Intronic
1045028793 8:98116194-98116216 AGGAAAAAGAAGATTTAGGAAGG - Intronic
1045040650 8:98220702-98220724 ATCAATAAAAAGAATTAGGCTGG - Intronic
1045173478 8:99696248-99696270 AAGAACAAGAAGCTTGAGGAAGG + Intronic
1046260444 8:111760066-111760088 ATGAGAAATAAGAATTAGGTAGG - Intergenic
1046498099 8:115040253-115040275 TTGAAAAAGAAGAAATAAGATGG - Intergenic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1048111008 8:131468881-131468903 GTCACCAAGAAGAATTAGCAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1050304734 9:4297068-4297090 ATAAAAGAGAAGAAGTAGGAAGG + Intronic
1050408051 9:5330661-5330683 AAGAAGAAGAAGAATTAGAGAGG + Intergenic
1050637124 9:7624255-7624277 ATAAACAACAAAAATTAGGTTGG + Intergenic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051798810 9:20907755-20907777 AAGAACAAGTAAAATTAGGTGGG - Intronic
1052050070 9:23836066-23836088 ATCAACATGAAGAGTTAAGAGGG - Intergenic
1052509035 9:29390764-29390786 ATGACCAGGAAGGATTAGGCTGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053404495 9:37860372-37860394 AGGAATAAGAAGAGTTTGGAAGG - Intronic
1054952409 9:70867319-70867341 ATGAGCAAGAGAAATAAGGAAGG - Intronic
1055194145 9:73566338-73566360 ATGGAAAAGAAGAGATAGGAAGG - Intergenic
1055247381 9:74263571-74263593 ATTAACAGGAAGAAAAAGGATGG - Intergenic
1055825993 9:80325533-80325555 ATGAACAAATAGAATTAGATGGG + Intergenic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1057425785 9:94948418-94948440 ATGAACTACAAGAGTTAGAATGG - Intronic
1058017654 9:100053990-100054012 ATATACAAGAAGAAATAGGGAGG - Intronic
1058457382 9:105150050-105150072 ATGAACAAGAAGAGTAGTGAAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059058110 9:111005570-111005592 AAAAAAAAGAAGAATTGGGAAGG + Intronic
1059072696 9:111155474-111155496 TTGAACAACAAGAATAAGCAGGG + Intergenic
1059894941 9:118852519-118852541 ATGCTCAAGAAGACTTAAGAAGG + Intergenic
1060743767 9:126116641-126116663 ATGAACAAGTAGATTTAGCCTGG - Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1187770921 X:22695088-22695110 ATGGATTGGAAGAATTAGGATGG + Intergenic
1188300170 X:28497812-28497834 ATGAACAAGAAGCATCAGATGGG - Intergenic
1189173057 X:38927667-38927689 TGGAACAAGAAAAATTAGGAGGG - Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189873402 X:45407739-45407761 AGGAACAAGAAAAATTACAAAGG - Intergenic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1191137866 X:57085110-57085132 ATGATCAAGAAGGATAAAGAAGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193160627 X:78225116-78225138 ATGAAAAACAAAAATTAGGTGGG + Intergenic
1194935902 X:99948588-99948610 ATGAAAAAGGAGAATTACAAGGG + Intergenic
1195645711 X:107228774-107228796 ATAAAAAAGAAAAATTAGCAGGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197622662 X:128768223-128768245 ATGAGAAAGAAGAATAAGCATGG + Intergenic
1197634904 X:128903976-128903998 ATGAACAAGCTGAACTAGGCTGG - Intergenic
1197876982 X:131119020-131119042 ATGAAAGACAAGAAATAGGAAGG - Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1197912681 X:131501597-131501619 AGGAACAAGAACTAATAGGATGG + Intergenic
1197966300 X:132066001-132066023 AAGAACAAGAGGAAATAAGAGGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic