ID: 1143449170

View in Genome Browser
Species Human (GRCh38)
Location 17:7025478-7025500
Sequence GGTCAGCCCAAAGCTTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143449164_1143449170 0 Left 1143449164 17:7025455-7025477 CCTATCCCCTTTCAGAGCTGAAT 0: 1
1: 0
2: 0
3: 21
4: 187
Right 1143449170 17:7025478-7025500 GGTCAGCCCAAAGCTTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1143449168_1143449170 -7 Left 1143449168 17:7025462-7025484 CCTTTCAGAGCTGAATGGTCAGC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1143449170 17:7025478-7025500 GGTCAGCCCAAAGCTTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1143449166_1143449170 -5 Left 1143449166 17:7025460-7025482 CCCCTTTCAGAGCTGAATGGTCA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1143449170 17:7025478-7025500 GGTCAGCCCAAAGCTTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1143449167_1143449170 -6 Left 1143449167 17:7025461-7025483 CCCTTTCAGAGCTGAATGGTCAG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1143449170 17:7025478-7025500 GGTCAGCCCAAAGCTTGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143449170 Original CRISPR GGTCAGCCCAAAGCTTGTCA GGG Intronic