ID: 1143449643

View in Genome Browser
Species Human (GRCh38)
Location 17:7028226-7028248
Sequence TTCCAGACCTAGAATTACAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 140}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143449643_1143449646 -6 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449646 17:7028243-7028265 CTGGAACCTTTATTTGTTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 228
1143449643_1143449653 22 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449653 17:7028271-7028293 TCTGGGAACATGCGGGATTGTGG 0: 1
1: 0
2: 0
3: 8
4: 102
1143449643_1143449650 5 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449650 17:7028254-7028276 ATTTGTTCTAGGGCAGCTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 182
1143449643_1143449652 15 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449652 17:7028264-7028286 GGGCAGCTCTGGGAACATGCGGG 0: 1
1: 0
2: 2
3: 37
4: 293
1143449643_1143449654 28 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449654 17:7028277-7028299 AACATGCGGGATTGTGGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 160
1143449643_1143449651 14 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449651 17:7028263-7028285 AGGGCAGCTCTGGGAACATGCGG 0: 1
1: 0
2: 0
3: 39
4: 388
1143449643_1143449647 -5 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449647 17:7028244-7028266 TGGAACCTTTATTTGTTCTAGGG 0: 1
1: 0
2: 0
3: 20
4: 176
1143449643_1143449655 29 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449655 17:7028278-7028300 ACATGCGGGATTGTGGAATTGGG 0: 1
1: 0
2: 1
3: 7
4: 97
1143449643_1143449649 4 Left 1143449643 17:7028226-7028248 CCCCTGTAATTCTAGGTCTGGAA 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1143449649 17:7028253-7028275 TATTTGTTCTAGGGCAGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143449643 Original CRISPR TTCCAGACCTAGAATTACAG GGG (reversed) Exonic
900995552 1:6121486-6121508 TTCCACACCTGGACTTCCAGGGG + Exonic
910071115 1:83214411-83214433 TTCCAAAACTAGAATTACCTTGG + Intergenic
910682292 1:89879327-89879349 TTGCAGAGCTAGAATTAATGAGG + Intronic
912419375 1:109532751-109532773 TTCCAGACCTAGAACTCTGGGGG - Intergenic
913550337 1:119911068-119911090 TTCAAGACTTAAAATTGCAGGGG + Intergenic
914898780 1:151700044-151700066 TTCCAGAATTAGAGTTACAGTGG + Intergenic
915242522 1:154533402-154533424 TTCCAAACTTAGAATTGAAGAGG - Intronic
924477530 1:244395065-244395087 TTCCAGTCCTCCAACTACAGAGG - Intergenic
924867129 1:247995866-247995888 TTCCAGATCCCGAATTACAATGG + Intronic
1064361864 10:14672964-14672986 TTCCTGACCAATAATTAAAGAGG + Intronic
1065759162 10:28965812-28965834 TTCCAAACTTAGAATAACACTGG - Intergenic
1065960937 10:30733678-30733700 TTCCAGAAGTGGAATTACTGGGG - Intergenic
1066810772 10:39331655-39331677 TTGCACACCTAGAAAAACAGTGG + Intergenic
1067865446 10:49900965-49900987 TTCCAGCCCTAGAAGTAAAATGG + Intronic
1071377802 10:85028038-85028060 TTTCTGACCTAGACTTACACTGG + Intergenic
1071397750 10:85239779-85239801 TGCCAGAACTAGAACTAGAGGGG - Intergenic
1071422164 10:85511526-85511548 TTCTCCACCTAGAAGTACAGTGG - Intergenic
1072226810 10:93377854-93377876 TTAGAGACATAGAAATACAGAGG + Intronic
1072563454 10:96598001-96598023 TTGCAGACCTATAATTATAGTGG + Intronic
1073275314 10:102305274-102305296 GTCCAGAATTAGAAGTACAGTGG - Intronic
1074661790 10:115667589-115667611 TTCCAGGCCTAGACTTTCAGAGG - Intronic
1078027986 11:7717134-7717156 TTCCTCACCTGGAATCACAGAGG - Intergenic
1080038221 11:27731470-27731492 TTCCAGATCTAAACTAACAGTGG + Intergenic
1089048049 11:115520858-115520880 TACCAGACATAGAAATACATGGG - Intergenic
1091661472 12:2387101-2387123 TTCCAGGCCTAGAGATGCAGTGG + Intronic
1092958332 12:13571082-13571104 TTCCAGACCTGGAGCTACAAGGG + Intronic
1094374554 12:29776142-29776164 TTCAAAACCCAGAATTATAGGGG - Intronic
1097445193 12:59661925-59661947 TTCTAAATCTAGAATTACAATGG - Intronic
1097822757 12:64144583-64144605 TACCATACCTAGAAATACATGGG - Exonic
1100549162 12:95630742-95630764 TTCCAGTCCTAGAATTATCTGGG - Intergenic
1101142539 12:101811170-101811192 TTCCAGTCCTTGATTTACAGTGG - Intronic
1101719890 12:107342156-107342178 TTCCAGACACAGGATCACAGTGG - Intronic
1107398635 13:40046559-40046581 TTCCAGATCTAGATATACATAGG + Intergenic
1107786720 13:43964948-43964970 TTCCACAGCTAGAATTCCAGAGG + Intergenic
1108476546 13:50824369-50824391 TGCCAGACCCAGAAGTCCAGGGG - Intronic
1109645192 13:65244821-65244843 TTACACACATAGAATTACAGGGG - Intergenic
1109982920 13:69934141-69934163 TTTAACACCTAGAATTATAGTGG + Intronic
1110015387 13:70393918-70393940 TTTCTGACCTAACATTACAGAGG - Intergenic
1110781951 13:79476783-79476805 CTCCAACCCTAGAGTTACAGGGG + Intergenic
1111014339 13:82357750-82357772 TTCCAGACATAAAATTGCAGGGG + Intergenic
1112604718 13:100892854-100892876 TTCCAGACATAGAAATTGAGTGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114252968 14:20977320-20977342 TTCCAGTCCTCTAATTAGAGAGG - Intergenic
1116110657 14:40576453-40576475 TTGTAGGCCCAGAATTACAGTGG + Intergenic
1116763047 14:49038502-49038524 TTCCAGACCTTGTATTTTAGTGG - Intergenic
1116824217 14:49656487-49656509 TTCCAGAAGTAGAATTACTTGGG - Intronic
1117767520 14:59098344-59098366 TTGAAGACCTTGAATTATAGAGG - Intergenic
1119084637 14:71728610-71728632 TTACAGACCCAGAAATACAGTGG - Intronic
1119881686 14:78104760-78104782 TGCCAGTCCCAGAAGTACAGTGG - Intergenic
1126461963 15:48924032-48924054 TTCTAGGCCTAGAATTTCATGGG + Intronic
1126501585 15:49351954-49351976 GTCAACACCTAGAACTACAGAGG - Intronic
1127863488 15:63013317-63013339 TTCCAGACCTAGATTTAGAGTGG + Intergenic
1129677247 15:77638312-77638334 TTCCTGACCTTGAGTTACTGTGG + Intronic
1131841057 15:96438107-96438129 TTCTAGACCAATAATTTCAGAGG - Intergenic
1138302137 16:55939500-55939522 TTCTGGTCCTAGAATAACAGAGG - Intronic
1139556946 16:67718573-67718595 TTCCAGAGCTACAAATACAAAGG + Intronic
1143449643 17:7028226-7028248 TTCCAGACCTAGAATTACAGGGG - Exonic
1148383941 17:47221273-47221295 TGACAGACCTATAATCACAGGGG - Intronic
1150421769 17:65043084-65043106 TTGCAGAACTAGAAATTCAGAGG + Intronic
1150465520 17:65389455-65389477 TTCCAGGCCTAGAGATTCAGTGG + Intergenic
1158769095 18:60493209-60493231 TTTCAGATCTTGAATTTCAGGGG + Intergenic
1167947064 19:52996776-52996798 TTCCAGTTTAAGAATTACAGGGG + Intergenic
1168258762 19:55181215-55181237 TTCCAGACCCAGAAATCCATGGG + Intergenic
926213835 2:10891322-10891344 TCCCAGACCCAGGATTAAAGTGG + Intergenic
926335882 2:11862419-11862441 GTCCAAAGCTAGAATTGCAGCGG + Intergenic
926855510 2:17251920-17251942 CTCCAGACCTCCAATTAAAGGGG + Intergenic
929438358 2:41946275-41946297 TTCCAGACCTGGAAGAACTGAGG + Intronic
929536107 2:42784953-42784975 TTCCTGAGGTAGAATTACTGAGG - Intronic
929951050 2:46409767-46409789 TTCCAGACCTTTAATTAGTGTGG + Intergenic
931613747 2:64133022-64133044 TTCTAGACCAAGAAATAAAGAGG - Intronic
936135312 2:109888054-109888076 CTCCAGACCTAGAATTTCTCAGG - Intergenic
936209385 2:110483431-110483453 CTCCAGACCTAGAATTTCTCAGG + Intergenic
936428571 2:112438670-112438692 CTCCAGACCTAGAATTTCTCAGG + Intergenic
936644427 2:114352128-114352150 TTCCAGACCTAGGTGTCCAGAGG + Intergenic
936980645 2:118262269-118262291 TTCCAGAAATAGAAATGCAGAGG + Intergenic
937149732 2:119678376-119678398 TTCCAGACGGAGAAGTACACGGG + Intergenic
939854927 2:147346667-147346689 TTCCAGACCTGGCATTTAAGAGG - Intergenic
946106365 2:217373576-217373598 CTCCAGGCACAGAATTACAGTGG + Intronic
947565226 2:231189276-231189298 TTCCAGTCCCATAACTACAGGGG - Intergenic
948194686 2:236086701-236086723 TTCCTGACCAAGAATTTAAGCGG - Intronic
948496527 2:238353526-238353548 TTCCAGAACTAGACTTGCAAAGG - Intronic
1169515064 20:6307529-6307551 TTCCAAACCTAGACCTAAAGAGG - Intergenic
1170350844 20:15439306-15439328 TAGCAGAACTAGGATTACAGTGG - Intronic
1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG + Intronic
1174852343 20:54007245-54007267 TTCCAGGGCTAGACATACAGGGG + Intronic
950661113 3:14467573-14467595 TTCCAACCCTGGAATGACAGTGG - Intronic
953417387 3:42730802-42730824 TACCAGAACTAGAGTTACACTGG + Intronic
954982499 3:54759300-54759322 TTCAAGACCTAGAATTTAACAGG + Intronic
957322092 3:78644305-78644327 TTCCAGACCTTACATTATAGTGG - Intronic
957557130 3:81777209-81777231 TTACAGACCTACAATTAAACAGG + Intergenic
963597614 3:147347542-147347564 CTCCTGACCTGGGATTACAGGGG - Intergenic
973706480 4:53585869-53585891 TGGCAGCCCTAGAAATACAGGGG + Intronic
974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG + Intergenic
978307484 4:107347418-107347440 TTCCAGATCAAGAATTACAGTGG - Intergenic
978678176 4:111344193-111344215 TTCAAGTCCTAGGAGTACAGAGG - Intergenic
982108232 4:152029761-152029783 TTCTAGACCTAGAACTAACGTGG - Intergenic
982939566 4:161532620-161532642 TTCCAGACACACAATAACAGTGG + Intronic
983153995 4:164321605-164321627 TTGCAGTCCTTGAATTTCAGGGG - Intronic
983831816 4:172337489-172337511 TTCCAGACATATAATCACAAAGG - Intronic
986166581 5:5277713-5277735 CTACAGTGCTAGAATTACAGGGG - Intronic
987717555 5:21592164-21592186 TTCCAGTCCTCTAATTACACAGG - Intergenic
991194634 5:63918412-63918434 TTCTAGACGTAGAATTTCTGGGG + Intergenic
991239471 5:64441125-64441147 TTCCTTACCAAGAATTCCAGAGG - Intergenic
992627736 5:78649401-78649423 TTCCACACCTAGATATTCAGAGG - Intronic
992969360 5:82040098-82040120 TTCCAGGCCTAGCCTTAAAGAGG - Intronic
993554387 5:89317539-89317561 TTCCTGACCTAGAGTCAGAGTGG + Intergenic
993569567 5:89520480-89520502 TTCCAGACCTGAAATGACTGAGG - Intergenic
1002379397 5:178815098-178815120 TTCAAGAAGTAGAAGTACAGTGG + Intergenic
1002684956 5:181002879-181002901 TTCCAGCCCTAGGCCTACAGGGG + Intronic
1004258258 6:14084858-14084880 TTCCCGCCCTAGGATTACAGGGG + Intergenic
1004433676 6:15569306-15569328 CTTCAGACCCTGAATTACAGTGG + Intronic
1008726540 6:54428203-54428225 TTAGAGACTTAGATTTACAGTGG - Intergenic
1011485342 6:87834981-87835003 TTTCAGACCTTCAATTACAATGG - Intergenic
1012946766 6:105474601-105474623 TTCAACACCTTGAATTACATGGG - Intergenic
1013228429 6:108138586-108138608 TTTCAGGTCTAGAATTCCAGCGG + Intronic
1016060460 6:139624464-139624486 TTCCAATCCTTGATTTACAGAGG - Intergenic
1016465445 6:144320676-144320698 TTCCATAGGTAGAATTACAGAGG + Intronic
1018164726 6:161082547-161082569 GTCCAGAACTAGAATAAAAGTGG - Intronic
1019022543 6:168931569-168931591 TTCCACTCCTAGATTTCCAGTGG - Intergenic
1019022568 6:168931667-168931689 TTCCACTCCTAGATTTCCAGTGG - Intergenic
1019022817 6:168932696-168932718 TTCCACTCCTAGATTTCCAGTGG - Intergenic
1019132897 6:169890460-169890482 TTCCAGAGTCAGAGTTACAGTGG + Intergenic
1019907066 7:4072847-4072869 TTCCAGGCCTCGAATTAAAATGG - Intronic
1021360607 7:19708059-19708081 TTGAAAACTTAGAATTACAGAGG - Intronic
1021642808 7:22756419-22756441 TTCCATAGCTAGGACTACAGGGG + Intergenic
1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG + Intergenic
1024436746 7:49365560-49365582 TTCCAGACCTAGTAATCCACAGG - Intergenic
1027288830 7:76679270-76679292 TTCCAAAACTAGAATTACCTTGG + Intergenic
1028057802 7:86269692-86269714 TTGAACACCTAGAAATACAGGGG + Intergenic
1030463378 7:109868841-109868863 TTTCTGACATAGAATTGCAGAGG - Intergenic
1031269090 7:119622113-119622135 TTCCAAACCTAGAAGGGCAGCGG - Intergenic
1032073871 7:128827044-128827066 TTGCAGAGCTAGAAGTAGAGAGG + Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1036736892 8:11327165-11327187 ATCCAGTCCTAGAATTTCAGAGG - Exonic
1037758117 8:21724496-21724518 TTGCAGACCTAGTACTGCAGAGG - Intronic
1042958007 8:74272382-74272404 TTTCACCCCTAGCATTACAGAGG - Intronic
1045056644 8:98373980-98374002 TTTCAGATCTAGAAAAACAGAGG - Intergenic
1046287601 8:112115190-112115212 TTCCAGACCCTGCATTCCAGTGG + Intergenic
1050650542 9:7771235-7771257 TTCCAGGCATAGAATGACGGTGG + Intergenic
1051732886 9:20165422-20165444 TACCACACCTTTAATTACAGAGG - Intergenic
1055339121 9:75263013-75263035 TTGCAGACTTAGACTTACAGAGG + Intergenic
1056744653 9:89289783-89289805 TAACAGACACAGAATTACAGAGG + Intergenic
1056752144 9:89359780-89359802 TTCCAGACCTAGGAGTGCTGGGG - Intergenic
1057013493 9:91629972-91629994 TTACAAACCTGGAATGACAGTGG + Intronic
1057989968 9:99758326-99758348 GTCCAGACTTAGAATTCCACAGG - Intergenic
1058858031 9:109085716-109085738 TTACAGAACTGGATTTACAGGGG + Intronic
1189674756 X:43450555-43450577 TTACAGAACTAGAATACCAGGGG - Intergenic
1189684741 X:43552171-43552193 TTACTGAACTAGAATTACAAAGG - Intergenic
1190888515 X:54549770-54549792 TCACATACCTAGAGTTACAGAGG + Intronic
1193491707 X:82158164-82158186 TCCCATATCTAGAATCACAGAGG + Intergenic
1195229020 X:102827564-102827586 GTCCAGACCTAAGAGTACAGTGG + Intergenic
1197553867 X:127930362-127930384 CTTGAGACCTAGAATTACTGGGG + Intergenic
1199018114 X:142843506-142843528 TTCAGCACCTAGGATTACAGAGG + Intergenic
1199908145 X:152256882-152256904 TCCCAAACCTAGAATTCCTGTGG + Intronic
1200172903 X:154091523-154091545 TGTCAGACCTAGAATGACTGGGG + Intronic
1200279117 X:154761949-154761971 AGCCAGACCTAGAGTTACCGGGG + Intergenic