ID: 1143449856

View in Genome Browser
Species Human (GRCh38)
Location 17:7029637-7029659
Sequence CTGTGCTGCCTGCTGTGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 12, 3: 47, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143449854_1143449856 -2 Left 1143449854 17:7029616-7029638 CCTTGGAATAAAGAAGCCTCTCT 0: 1
1: 0
2: 3
3: 25
4: 239
Right 1143449856 17:7029637-7029659 CTGTGCTGCCTGCTGTGTCCTGG 0: 1
1: 0
2: 12
3: 47
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143449856 Original CRISPR CTGTGCTGCCTGCTGTGTCC TGG Exonic
900198022 1:1387235-1387257 CTCCGATGCCTGCTGTGCCCAGG + Exonic
900294756 1:1943333-1943355 ATGTGCAGCCTGCGGTGACCCGG - Intronic
900303335 1:1988880-1988902 CCGAGTTACCTGCTGTGTCCCGG + Exonic
900354740 1:2254990-2255012 CTGTGGTGCGTGCTGTGGACTGG + Intronic
900375310 1:2351563-2351585 CTGTGTGGCCTGGTGTGGCCGGG + Intronic
900404487 1:2486432-2486454 CTGTGATGCCTGGGGTGGCCTGG + Intronic
900466550 1:2828466-2828488 CTGGAGTGCCTGCTGTGGCCTGG + Intergenic
900684372 1:3938607-3938629 CTTTGCTGCCTGGTGTCTCATGG + Intergenic
900987816 1:6083299-6083321 CTTCGCTGCCTGCTTTGGCCTGG + Intronic
901059718 1:6466345-6466367 CTGGGCTGCCTGCTGCGACCAGG + Exonic
901190675 1:7408080-7408102 CTGTCCCGCCTGCTCCGTCCAGG + Intronic
901202510 1:7474718-7474740 CTCTGCTCCCTTCTCTGTCCGGG - Intronic
901429413 1:9203828-9203850 CTGTGCAGCCTGCGCTGTGCTGG + Intergenic
901955566 1:12782703-12782725 CTGTGCTGCCTGCTGTGGCGGGG + Intergenic
901978938 1:13018754-13018776 CTGTGCTGCCTGCTGTGGCGGGG + Intronic
901988029 1:13091527-13091549 CTGTGAGGCCAGCTCTGTCCTGG + Intergenic
901993783 1:13135240-13135262 CTGTGAGGCCAGCTCTGTCCTGG - Intergenic
902003144 1:13210184-13210206 CTGTGCTGCCTGCTGTGGCGGGG - Intergenic
902022369 1:13355934-13355956 CTGTGCTGCCTGCTGTGGCGGGG - Intergenic
902435354 1:16395057-16395079 TTGGGCTGCCTGCTGTCTTCGGG - Exonic
903191687 1:21660030-21660052 CTGCCCTGGCTGCTCTGTCCTGG + Intronic
903363110 1:22789487-22789509 CTCTGGTGCCTACTGTGTACAGG + Intronic
903685677 1:25130393-25130415 ATTTGCTGCCTGATGTCTCCAGG + Intergenic
903972960 1:27131034-27131056 CTGTGCTGGCTGCTGAGACTGGG + Intronic
904082286 1:27879831-27879853 CCGCTCTGCCCGCTGTGTCCTGG + Exonic
904203901 1:28840052-28840074 CTGTGCTGGGTGCTAGGTCCTGG + Intronic
904836424 1:33340468-33340490 CTGTGTTTGCTGCTGTCTCCTGG - Intronic
904959800 1:34323377-34323399 CTGAGCTGCCTTGGGTGTCCAGG + Intergenic
905770882 1:40637130-40637152 CTGTGCTGCCTGTCCTGCCCTGG - Intronic
908858252 1:68453280-68453302 CTGTGCTGCCTTTGGTGTTCTGG + Intergenic
911264413 1:95726281-95726303 GTGTGCTGCCTTGGGTGTCCTGG - Intergenic
911331936 1:96534516-96534538 GTGTGCTGCGTGCTGTGTGCTGG + Intergenic
912659044 1:111512552-111512574 CTGTGCTAACTGCTGTGCCTGGG - Intronic
913110754 1:115655157-115655179 CTCTGCTGGCTGCTGGGGCCCGG - Intronic
913254586 1:116942180-116942202 CTCTGCTCCCTCCTCTGTCCAGG + Intronic
915087401 1:153397851-153397873 CAGGGCCGCCTTCTGTGTCCAGG + Intergenic
915228254 1:154427239-154427261 CAGTACTGTGTGCTGTGTCCTGG + Intronic
915347862 1:155207254-155207276 CTCCTCTGCCTCCTGTGTCCTGG + Intronic
915458861 1:156057848-156057870 CTGAACTTCCTGCTGTGCCCAGG + Intronic
916058804 1:161085309-161085331 CTGTGCTGGGAGCTGTGTCTGGG - Intronic
917293758 1:173497144-173497166 CACTTCTGCCTGGTGTGTCCTGG + Intergenic
917821506 1:178768644-178768666 CTGTGCTCCCTCCTCAGTCCTGG + Intronic
918167798 1:181967079-181967101 CAGTGCTACCTGCTTTGTCTTGG + Intergenic
918379248 1:183937924-183937946 CTGTGCATCCTGCCCTGTCCCGG - Exonic
918451779 1:184665482-184665504 CTGGAATGCCTGCTGTGTCAAGG + Intergenic
919989400 1:202698677-202698699 CTGTTCTGCCTGGTGAGTCTGGG - Intronic
920023540 1:202975013-202975035 CCATGCTGCCTGCTGTGCCATGG - Intergenic
920670687 1:208001874-208001896 GTGGGGTGCCTGCTGTTTCCTGG + Intergenic
921134503 1:212248229-212248251 CTGTGCTGCCTACTGTCACCTGG - Intergenic
922965858 1:229690216-229690238 CAGTGTTGTCTGCTGGGTCCTGG - Intergenic
923041712 1:230324276-230324298 CTGTCGTGCCTGCTCTGTGCTGG - Intronic
923391450 1:233516708-233516730 CTGTGGTTCCTGATGTCTCCAGG + Intergenic
924291477 1:242541156-242541178 CTTTGCTGATAGCTGTGTCCAGG - Intergenic
1063290726 10:4744231-4744253 TTTTGCTGCCTCCTGTGTCTTGG - Intergenic
1063462422 10:6223074-6223096 CTGTGTTGGCTGCTGTGCCATGG + Intronic
1067215784 10:44301570-44301592 CTGTGCTGGCTCCTGGCTCCTGG - Intergenic
1067438378 10:46294458-46294480 CTGTGCTCCCTGCTGGGCCTGGG - Intronic
1067467145 10:46509550-46509572 CAGTGATGCCTGCTGTTTGCAGG + Intergenic
1067511187 10:46896137-46896159 CTGTTCTGCCTCCTATGTACAGG + Intergenic
1067536206 10:47112095-47112117 CTGTGCTACCTGCTGCGGCATGG + Intergenic
1067620041 10:47875055-47875077 CAGTGATGCCTGCTGTTTGCAGG - Intergenic
1067651065 10:48155725-48155747 CTGTTCTGCCTCCTATGTACAGG - Intergenic
1068654422 10:59560031-59560053 ATTTGGTGCCTGCTGTTTCCAGG - Intergenic
1069817343 10:71206864-71206886 CTGTGCTCACTGCTATGTGCTGG + Intergenic
1070000711 10:72374883-72374905 CTCTGCTCCCTGCTGCCTCCCGG + Intronic
1070730823 10:78827063-78827085 GTGTGCTGCCTGGTGGCTCCTGG - Intergenic
1071259559 10:83907785-83907807 CTCTACTGCCTGCAGTGTCTTGG - Intergenic
1071433639 10:85626326-85626348 CTGTGCTGTCTCCTCTGCCCTGG + Intronic
1072155118 10:92716894-92716916 CTCTGCTTCCTGCTGAGTTCTGG + Intergenic
1074298568 10:112212812-112212834 CTGTGCTGAGTGCTTTGCCCTGG - Intronic
1074744917 10:116522952-116522974 ATGTGCTGCCTGTTCTGCCCTGG - Intergenic
1075074088 10:119339005-119339027 CTGTACAGGCTGCTGTGTTCTGG - Intronic
1075671754 10:124267914-124267936 CTGTGCCCCCATCTGTGTCCAGG - Intergenic
1075733195 10:124648403-124648425 GGCTGCGGCCTGCTGTGTCCTGG + Intronic
1075841897 10:125511908-125511930 CTGTGCAGCCAGCTGGTTCCGGG - Intergenic
1075944977 10:126424903-126424925 CAGTGGTGCCTGCTGGGTCTTGG + Intergenic
1076481482 10:130787954-130787976 CTGTGCTCCCTGCCATGTGCAGG - Intergenic
1076536538 10:131181382-131181404 CTGAGCTGAGTGCTGTGCCCAGG - Intronic
1076634235 10:131872316-131872338 CAGGGCAGCGTGCTGTGTCCTGG + Intergenic
1077112759 11:869170-869192 CCATGCTCCCTGATGTGTCCAGG + Exonic
1077217018 11:1399166-1399188 CTGTGCTGTCTGTTGTGGGCAGG + Intronic
1077263150 11:1633997-1634019 CTGTGCTGCCCACCGTGCCCAGG - Intergenic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077663540 11:4089619-4089641 CTCTGCTGCCTGCTGAGTCCAGG + Intronic
1077665301 11:4102898-4102920 CTGTGGTCTCTGCAGTGTCCTGG + Intronic
1078090069 11:8259560-8259582 CACTGCTGCCTGCTGAGGCCTGG - Intronic
1079869505 11:25780485-25780507 GTGTTCTGCCTGCTCTGTCTGGG - Intergenic
1082812117 11:57484637-57484659 CTGAGGTGCCAGCTGTGTCCTGG - Exonic
1083140619 11:60718317-60718339 CTGTGCTGGCTGCTGTGGTGGGG + Intergenic
1083155488 11:60820513-60820535 CTGGGCTGCCTCATGTCTCCTGG - Intergenic
1083430248 11:62610726-62610748 CTGGGGCGCCTGCTGTGTACCGG - Intronic
1083783858 11:64932835-64932857 CTGTGCTGCCTGCTGTGTTTGGG + Exonic
1083857488 11:65400362-65400384 CCCTGCTGCCATCTGTGTCCTGG + Intronic
1084565376 11:69925568-69925590 CTGGGATGCCTGCTGTGGTCTGG - Intergenic
1088036177 11:105318686-105318708 CTGTGCTGCCTGTGGTCTGCAGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1089993407 11:122882853-122882875 CTGTGTTGTCTGCGGTCTCCAGG + Exonic
1091825382 12:3508654-3508676 CTTCTCTGCCTGCTGTCTCCGGG + Intronic
1091828810 12:3534874-3534896 CTGTGCTGCTTGCTATCTCTGGG + Intronic
1092524883 12:9303689-9303711 TTGGTCTGGCTGCTGTGTCCCGG + Intergenic
1092542384 12:9428130-9428152 TTGGTCTGGCTGCTGTGTCCCGG - Intergenic
1094332252 12:29307122-29307144 GTGTGCTGCATGCTGTGTTCAGG - Intronic
1094510631 12:31094304-31094326 TTGGTCTGGCTGCTGTGTCCCGG + Intronic
1095970872 12:47901318-47901340 CTGTCCTGCCTTCTGGGTCCTGG - Intronic
1096103170 12:48981439-48981461 CTGCCGTGCCTGCTGTGCCCAGG - Exonic
1096183673 12:49565017-49565039 CTGTGCTTCCTGTTGTGGGCTGG - Intronic
1098213042 12:68186303-68186325 CTCTTCTGCCTGCTGTGTTTGGG - Intergenic
1100016213 12:90013869-90013891 CTGTGATGTCAGCCGTGTCCAGG + Intergenic
1100432883 12:94546325-94546347 CTGTGCTGGCTACAGTGTCTTGG - Intergenic
1100757098 12:97763545-97763567 ATGTGCTGCCTGCTGCTTCAAGG - Intergenic
1101751068 12:107582767-107582789 CTGTGCTGCCTCCTGTTTTCAGG + Intronic
1102705050 12:114874063-114874085 CTGTGCTGTATGTTGTGTCTTGG - Intergenic
1102736866 12:115169768-115169790 CCGTGCTGCCTCCTTTCTCCAGG + Intergenic
1102980926 12:117240664-117240686 CTGTGCTGAGTCCTCTGTCCAGG - Intronic
1103793827 12:123490060-123490082 CACTGCTGCCTGCAGGGTCCAGG - Intronic
1103915021 12:124371771-124371793 CAGGGCTGCCTCCTCTGTCCGGG + Intronic
1103940576 12:124499351-124499373 CTGTGGTCCCTGCTGAGCCCCGG + Intronic
1104490482 12:129189514-129189536 CTGTGAGGGCTGCTGTGGCCTGG + Intronic
1104889356 12:132132858-132132880 CTGTGCTGCCTGCCCCGGCCTGG + Intergenic
1105778406 13:23683752-23683774 CACTTCTGCCTGGTGTGTCCTGG + Intergenic
1107560577 13:41553708-41553730 GTCTGGTGCCTGCTGTCTCCTGG + Intergenic
1107704602 13:43088356-43088378 CTGGGCTTTCTGCTCTGTCCCGG + Intronic
1107988354 13:45795428-45795450 CTCTGTTGCCTGCTGAGTGCTGG - Intronic
1108507570 13:51126654-51126676 GAGTGCTGCCTGCGTTGTCCTGG + Intergenic
1108594559 13:51938200-51938222 TCCTGCTGCCTGCTCTGTCCTGG + Intronic
1109933278 13:69245089-69245111 CTGAGCTGCCTGTTGTGGACTGG - Intergenic
1111091633 13:83453719-83453741 CTGTGTTTCCTGGTGTCTCCAGG + Intergenic
1112293837 13:98168849-98168871 CTGTACTTCCTGCTGTGGGCAGG + Intronic
1113615869 13:111680458-111680480 CTGTGCTGCCCGCCGTGGACGGG - Intergenic
1113621337 13:111765351-111765373 CTGTGCTGCCCGCCGTGGACGGG - Intergenic
1113857912 13:113458858-113458880 CTTTGGAGCCTGCTGTGTGCTGG - Intronic
1113911611 13:113843969-113843991 CAAGGCTGCCTGCTGTGGCCAGG + Intronic
1114607893 14:24012921-24012943 CTGCGCTGCCTGCTGTGGTGGGG + Intergenic
1115777495 14:36731796-36731818 CTGTGCAGCCTGCTCTTCCCTGG + Intronic
1118768717 14:68927634-68927656 CCGAGCTGTCTTCTGTGTCCAGG - Intronic
1119174438 14:72558952-72558974 CTGAGCTGGCTGCGGTTTCCTGG + Intronic
1119736510 14:76986084-76986106 CTGTGCTGGGGGCTGTGGCCTGG + Intergenic
1120838377 14:89061381-89061403 CAGTGCTGCCTTCAGGGTCCTGG - Intergenic
1121300607 14:92867756-92867778 GCGTGCAGCCTGCTGTGCCCAGG - Intergenic
1121446373 14:93981582-93981604 CTGTGTCTCCTGCTGTGCCCAGG + Intergenic
1121456316 14:94040998-94041020 CCCTGCTGGCTGCTGTGTGCAGG + Intronic
1121525450 14:94616167-94616189 CTAGGCTGGCTACTGTGTCCTGG - Intronic
1121659566 14:95624640-95624662 CAGTCCTGCCTGCTCTGTCCAGG - Intergenic
1121717925 14:96089482-96089504 CTGTACTGCCTTCTGTGACTGGG + Exonic
1122283235 14:100636556-100636578 CTGTGATGCCTGCCCTGTCCCGG + Intergenic
1122605603 14:102945595-102945617 CTGTGCTGTCTGCAGAGGCCAGG + Intronic
1122661895 14:103301669-103301691 CTGAGCACCCGGCTGTGTCCAGG - Intergenic
1122886466 14:104712621-104712643 CTGTGCTGTCTCCTGGCTCCAGG + Intronic
1122971987 14:105156092-105156114 TGCTGCTGCCTGCTGTGCCCCGG - Intronic
1123972350 15:25519784-25519806 CTGTGGATCCTGCTGTGTTCTGG - Intergenic
1125672165 15:41481541-41481563 CTGACCTGCAGGCTGTGTCCTGG + Exonic
1128149128 15:65350781-65350803 CACTTCTGCCTGGTGTGTCCTGG + Intronic
1129242872 15:74261880-74261902 CTGAGATGCCTGCTGTGTGCAGG - Intronic
1129671455 15:77610148-77610170 CTGTGCTGCTTTCAGTCTCCTGG + Intergenic
1129825427 15:78631732-78631754 CTGGTCTTCCTGCTCTGTCCTGG + Intronic
1132314818 15:100881822-100881844 TGCTGCTGCCTGCTCTGTCCTGG + Intronic
1132665842 16:1080989-1081011 CAGTGCTGTCTGCTGTGGCCTGG - Intergenic
1132813950 16:1817155-1817177 AGGCGCTGCCTACTGTGTCCGGG + Exonic
1133408880 16:5551451-5551473 TTGTGCTGCCTGCTGCAGCCAGG + Intergenic
1133765165 16:8832776-8832798 CTGTGAGGCCCGCTGTGGCCCGG + Intronic
1134245731 16:12538568-12538590 CTGAGCTGGCTTCTGTGTCTGGG + Intronic
1135500497 16:22991784-22991806 CAGGGCTGCCTGCTGATTCCTGG - Intergenic
1135733897 16:24915770-24915792 GTGTGCAGCCTGCTGTGGGCAGG + Intergenic
1135991346 16:27220623-27220645 CTGTCCTGCATCCTGTCTCCTGG + Exonic
1136116763 16:28099458-28099480 CTGAGCTGGCTGCTGGGGCCAGG - Intronic
1136348574 16:29692703-29692725 CTGTGGCGCCTGCAGTGGCCTGG - Intronic
1136461338 16:30412161-30412183 CTTTGCTCCCTGCTTTCTCCAGG + Intronic
1136630372 16:31486314-31486336 CACTGCTGCCAGCTGTGGCCAGG + Intronic
1137702268 16:50505882-50505904 CTGTGCTGACATCAGTGTCCTGG - Intergenic
1138451649 16:57096809-57096831 CTGGCCTGCCTGATGTGCCCTGG - Intronic
1138460653 16:57145862-57145884 TTGTACTTCCTGCTGTGACCAGG + Intronic
1139036485 16:62953691-62953713 ATGTGTTGCCTGCTGTATTCTGG + Intergenic
1139635851 16:68257978-68258000 CAGCTCTGCCTGCTGTGGCCTGG - Intronic
1139891339 16:70254887-70254909 CTGTGCTCCTTGCTGGGGCCTGG - Intronic
1140252251 16:73304456-73304478 CAGGGTTGTCTGCTGTGTCCAGG + Intergenic
1140934003 16:79653808-79653830 CTGCCCTGCCTGCTGTGGCTGGG + Intergenic
1141008719 16:80376971-80376993 CTGCAATGCCTTCTGTGTCCCGG - Intergenic
1141147739 16:81543448-81543470 CAGGGCTCCCTGCTGCGTCCTGG + Intronic
1141165964 16:81661313-81661335 CCGTGCTGCCTCCCGTGTTCAGG - Intronic
1141572315 16:84941415-84941437 GTGCGCCGCCTGCGGTGTCCCGG + Intergenic
1141881537 16:86863473-86863495 CTTTGCTCCCTGCTGTGCCCAGG + Intergenic
1141907974 16:87040317-87040339 CTGTTCAGCCTCCTGGGTCCTGG - Intergenic
1141954909 16:87364276-87364298 TTGAGCTTCGTGCTGTGTCCTGG - Intronic
1142259851 16:89037578-89037600 CTGTGCTGCCTACTGTGGACGGG + Intergenic
1142379298 16:89722399-89722421 CCGAGCCGCTTGCTGTGTCCGGG + Intronic
1142602514 17:1061151-1061173 CTGTGCTGCCTGGGGTGTGCCGG - Intronic
1142640334 17:1281636-1281658 CTGTGATGCCTGCTGTACCTGGG + Intronic
1142866967 17:2797143-2797165 CTGGGCTGCCTGCTGTCTTGGGG + Intronic
1143285419 17:5785498-5785520 CTGTGCTGCCTGCTTTTTGCCGG + Intronic
1143449856 17:7029637-7029659 CTGTGCTGCCTGCTGTGTCCTGG + Exonic
1143524315 17:7463355-7463377 CTGGGCTGACTGCTGTGGCTGGG + Exonic
1144825730 17:18104740-18104762 CTGTTCTGCCTGAGGTGCCCTGG + Intronic
1146933800 17:36797446-36797468 CGCTGCTGGCAGCTGTGTCCTGG - Intergenic
1147662092 17:42122266-42122288 CTGTGCTGCAGGCTGTGGTCTGG - Exonic
1148775209 17:50091430-50091452 CTTTGCTTCCTGCCATGTCCTGG + Intergenic
1148876494 17:50690391-50690413 CTGGGCTCCCAGATGTGTCCTGG - Intronic
1149137158 17:53381335-53381357 CTGAGCTCCCTGCTCAGTCCTGG + Intergenic
1149304419 17:55334585-55334607 CTGTGCAGCATCCTGTGGCCTGG + Intergenic
1150078689 17:62216974-62216996 CTGTGGGGCCTGCTGGCTCCTGG + Intergenic
1150318320 17:64188385-64188407 CTGTTGTGTCTGCTGTGTGCAGG + Exonic
1152083669 17:78204590-78204612 CTACGCTGCTTCCTGTGTCCTGG - Intronic
1152267547 17:79305088-79305110 CTGTGCTTCCTGCCCTGGCCAGG - Intronic
1152488244 17:80609935-80609957 CTGCAGTGCCTGCTGGGTCCTGG + Intronic
1152714935 17:81894638-81894660 CTGTGCTGTCTGCTGCCTGCTGG + Intronic
1152890907 17:82881147-82881169 CTGGGCTTGCTGCTGTGGCCTGG + Intronic
1153456532 18:5288668-5288690 CTCTCCTGTCTGCTGGGTCCTGG - Intergenic
1153835337 18:8959019-8959041 GTGTTCAGCCTGCTGTGTCTCGG - Intergenic
1156354650 18:36330720-36330742 CTGTGCAGCCTGCTGTTTATGGG + Intronic
1156376707 18:36521307-36521329 CTGTGGAGCCAGCTGTGCCCTGG + Intronic
1156455610 18:37291881-37291903 CTGTGTTCCCTGCTGTGGTCTGG + Intronic
1156722300 18:40084924-40084946 CTGTGCTGCATGCGGTCTGCAGG - Intergenic
1157570457 18:48708910-48708932 CTGTGCTGCCTTGTTTGTCCTGG + Intronic
1157622734 18:49025683-49025705 CTGCTCTGCCAGCTCTGTCCTGG + Intergenic
1158970268 18:62659847-62659869 CTGTGATGCCTCATGTCTCCTGG + Intergenic
1159365741 18:67464153-67464175 CTGAGCTCCCTGCTCAGTCCTGG + Intergenic
1160103461 18:75945989-75946011 CTGTGCAGACTGCCGTGTCTAGG - Intergenic
1160664754 19:320515-320537 CTGTGCGGCCAGCTGTGGCCTGG - Intronic
1160873784 19:1288123-1288145 CTCTCCTGCCTGCGGTATCCAGG + Intronic
1160988070 19:1848634-1848656 CTGCCCTGCCTGCGGTCTCCGGG + Intergenic
1162276480 19:9659653-9659675 CTGAGCTGCCTGTTGTGTAAAGG + Intronic
1162439295 19:10682736-10682758 CATGGCTGCCTGCTCTGTCCAGG - Intronic
1162693477 19:12452783-12452805 CAGCGCTGCCTGCTGTGGCGGGG - Intronic
1163148280 19:15396993-15397015 CTGTGCTGCCTGCACTGAGCTGG + Intronic
1163149438 19:15402277-15402299 CTGCGGTGCCCTCTGTGTCCTGG - Intronic
1163152266 19:15422514-15422536 CTGTGGGGCCTGCTGGGGCCTGG - Exonic
1163375725 19:16929091-16929113 CGATCATGCCTGCTGTGTCCTGG + Exonic
1164507461 19:28871443-28871465 CTGTGGTGTCTGCACTGTCCTGG - Intergenic
1164624243 19:29715636-29715658 CTGTGCTCTCTTCTGTGCCCAGG - Intronic
1164880132 19:31726032-31726054 CAGTCCTGCCTCCTGTGTCTGGG - Intergenic
1165263972 19:34645348-34645370 CTGTCCTCCCTGGAGTGTCCTGG - Intronic
1167228756 19:48268190-48268212 CTGTTCTACTTTCTGTGTCCAGG - Intronic
1167468294 19:49661898-49661920 CTGTGCAGGCTGCTTTGTACTGG + Intronic
925752087 2:7097782-7097804 CTGTGATGCCTGCTGGGCCCAGG - Intergenic
925753436 2:7110294-7110316 CAGTGGGGCCTGCTGTGTGCTGG - Intergenic
925832809 2:7912638-7912660 CTGAGCTGCCTGCTGGGCCTGGG + Intergenic
925879411 2:8339698-8339720 CCATGCTGCCTGCTGTGTTAAGG + Intergenic
926271249 2:11368285-11368307 CTGGGCTCTCGGCTGTGTCCAGG - Intergenic
927706870 2:25301808-25301830 CTGTGCTGCCAGCACTGCCCTGG - Intronic
928314768 2:30236655-30236677 CTGTGCTGGCCTCTGTGCCCAGG + Intronic
928367948 2:30717162-30717184 CTGTGCTGGCTGTTGTCTCTTGG + Intergenic
930313542 2:49771319-49771341 CTGTGTTTCCTGGTGTTTCCAGG - Intergenic
930421054 2:51153264-51153286 CAGTCCTGCCTTCTGTGACCTGG + Intergenic
930530106 2:52579612-52579634 CTGTGCTCCCTGCTCGTTCCTGG + Intergenic
930674663 2:54187628-54187650 CAGTGCTGCCTGCTGTGCAATGG - Intronic
931681318 2:64751581-64751603 CTGTGCTGCCTACTCTGATCCGG + Intergenic
932101891 2:68908764-68908786 CTGTGCTGCCTGCTGCTCCCTGG + Intergenic
932579777 2:72985617-72985639 CTGGCCTGGCTGCTGAGTCCTGG - Intronic
932846984 2:75146038-75146060 CTTTACTGCCCGCTCTGTCCTGG - Intronic
933989215 2:87621641-87621663 CTGTCCTGCCTGCTATCTCCTGG - Intergenic
934906543 2:98210014-98210036 CTGGGCTGCCTGCTGTTGCTGGG + Intronic
934925677 2:98380381-98380403 CTCTGGTGCCTGCTGGGGCCAGG + Intronic
935563435 2:104581987-104582009 AGGTGCTGCCTGCTGTGTTCTGG + Intergenic
935939239 2:108221164-108221186 CTGCCCTGCCAGCTGTGCCCAGG - Intergenic
936017640 2:108971900-108971922 CTGAGCTTCCTGCTGTGCCGTGG + Intronic
936304628 2:111329185-111329207 CTGTCCTGCCTGCTATCTCCTGG + Intergenic
936628065 2:114170022-114170044 CTGTGCTGCCTTGGGTCTCCTGG + Intergenic
936668118 2:114621924-114621946 CTGGGCTGGCTGCTGTGGCAGGG + Intronic
937887469 2:126909667-126909689 ATGTCCTGCCTCCTGTTTCCAGG + Intergenic
938080488 2:128367457-128367479 GTGTGCTGCCTGCTGGGTGCAGG + Intergenic
938341097 2:130537252-130537274 CTGTGCAGCCTACTGTGTTTCGG + Intergenic
938348733 2:130583457-130583479 CTGTGCAGCCTACTGTGTTTCGG - Intronic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
942342134 2:174959864-174959886 CTGCGGTGACTGCTGTGACCTGG + Intronic
944525655 2:200616367-200616389 CTCTGATGCCTGCAGTGCCCAGG - Intronic
945126862 2:206521360-206521382 CTGTGGTTCCTGGTGTTTCCTGG + Intronic
945250480 2:207761704-207761726 ATGTGCTAACTACTGTGTCCCGG + Intronic
946456322 2:219829433-219829455 CAATGCTGCCTTCTGTGTCTAGG + Intergenic
948564177 2:238873130-238873152 CTGGCCTCCCTACTGTGTCCAGG - Intronic
948650822 2:239442570-239442592 CTGTGCTGCCTTCTGTCTCCTGG - Intergenic
948912586 2:241011876-241011898 CTGTCCTGGCTGCCCTGTCCTGG + Intronic
1168880804 20:1204595-1204617 CTGAGCTGCCTCCTCTCTCCTGG - Intronic
1168903106 20:1382524-1382546 CTGGCCTGCGTTCTGTGTCCTGG + Intronic
1169009251 20:2236676-2236698 CTGCGCAGCCAGCAGTGTCCCGG - Intergenic
1169812179 20:9619522-9619544 CTGCCCTGTCTGCTGTGTTCAGG + Intronic
1170534731 20:17328906-17328928 CTCTGCTGTTTGCTGTGTTCTGG - Intronic
1170708593 20:18768345-18768367 CTGGGCTGTCTGCAGTGTCTGGG + Intergenic
1170747736 20:19115688-19115710 CTATACTGCCTGCTGTGGTCCGG + Intergenic
1170840660 20:19922440-19922462 CTGTGCAGCCTGATGTTTCTAGG + Intronic
1170965286 20:21063279-21063301 CTGTTCTGCCTGGCTTGTCCTGG - Intergenic
1171034442 20:21704539-21704561 CTGTGCAGCTAACTGTGTCCGGG - Intergenic
1172299434 20:33838805-33838827 CAGGGCTGCCTGCTGGGTCTAGG + Intronic
1172648193 20:36484548-36484570 CTCTCCTGCCACCTGTGTCCTGG + Intronic
1172689135 20:36778521-36778543 CTGAGCAGCCTGGTGTCTCCTGG + Exonic
1173733908 20:45346473-45346495 CTGAGCAGTCAGCTGTGTCCTGG - Intronic
1173840410 20:46153270-46153292 CTCTGCAGCCTGCCTTGTCCAGG + Intergenic
1174068513 20:47883324-47883346 CTGCGCTACCTCCTCTGTCCTGG + Intergenic
1175687149 20:61039863-61039885 CTGAGCTTCCTGCTGTGCCCTGG - Intergenic
1178931346 21:36821227-36821249 CTGAGCTGGCCACTGTGTCCAGG + Intronic
1179459847 21:41526961-41526983 GTGTGCTGCCTGGGGTGACCAGG - Intronic
1179536797 21:42058159-42058181 CTCTTCTGCCTGCTGCTTCCTGG + Intergenic
1180013295 21:45065426-45065448 CATTGCTGACTGCTGTGACCTGG - Intergenic
1180069757 21:45430442-45430464 CTCTGCTGCCTGCTGCTTGCTGG + Intronic
1180134446 21:45853127-45853149 CTCTGGAGCCTGCTGTGACCTGG + Intronic
1180162419 21:46004158-46004180 CGCTGCTGCCTGCTTTGTGCAGG + Exonic
1181168053 22:20993776-20993798 CTGCTCTGCCTGCTGTGCCTGGG + Intronic
1181535533 22:23540994-23541016 CGGTGCTGCCTGCTGTGGCGCGG - Intergenic
1181625726 22:24121002-24121024 CTGGGCTGCTTGCTCTGTCTGGG - Intronic
1182046136 22:27275623-27275645 CTGTGCTGTCTGCTGGGGACAGG - Intergenic
1182151662 22:28031439-28031461 GTCTGCTGCCTGCAGTGCCCTGG - Intronic
1182437315 22:30338981-30339003 CTGGGCAGCCTGCTGGGTCCGGG + Exonic
1183175674 22:36223219-36223241 CTGGGATGCCAGCTGTGCCCAGG + Intergenic
1183396526 22:37574577-37574599 CTTTGGTGCCTGTTGCGTCCTGG - Intronic
1184098916 22:42331308-42331330 CTGTGAGGCCAGCTGTTTCCAGG - Intronic
1184342588 22:43894084-43894106 CTGTGCTGCCTGCTGTCTCTGGG - Intergenic
1184753530 22:46502908-46502930 TTGTGCAGCTTGCTGTCTCCCGG - Intronic
1184856969 22:47151620-47151642 CTGTGCTGGCTGCTGAGCCAGGG + Intronic
1184859685 22:47166100-47166122 GTGTGCTCTCTGCTGTGCCCGGG + Intronic
1184869107 22:47222299-47222321 GCGTGCTCCCTGCTGTGTGCCGG + Intergenic
1185096297 22:48807864-48807886 CTGCTCTGCCTGCTCTGTGCAGG + Intronic
949970631 3:9399972-9399994 TAGTGCTGGCTGCTGTCTCCAGG + Intronic
950048775 3:9969831-9969853 CTGGGGTGCTTGCTGAGTCCTGG - Intronic
950551793 3:13670514-13670536 CTGTACTTCCTGCTTTGTGCTGG + Intergenic
950970313 3:17179926-17179948 CTGAGCTGCCAGCTGTTTACAGG - Intronic
952139568 3:30463424-30463446 CTTTGCTCCCTGATGTGTTCTGG - Intergenic
952255458 3:31691355-31691377 CTGTGCTCCCTGCTGTGGGGAGG - Intronic
953242747 3:41164311-41164333 GTGTGCTTCCTGCTGTTTTCAGG - Intergenic
953818436 3:46182974-46182996 CTGTGCTCCCTGCTGGGTAGGGG + Intronic
958124779 3:89341828-89341850 CTTTCCGGCCTCCTGTGTCCAGG - Exonic
960722887 3:120642031-120642053 CTGGGCTACCTTCTGTTTCCTGG + Intronic
961168831 3:124781387-124781409 CTGTGCTGCCTGGTGTTCTCAGG + Intronic
961198288 3:125022487-125022509 CAGAGCTGCCGGCTGTGTTCTGG - Intronic
961450354 3:126999736-126999758 GAGCCCTGCCTGCTGTGTCCTGG + Intronic
961815468 3:129547936-129547958 CTGTGCTAACTTCTGGGTCCTGG + Intronic
964880827 3:161420850-161420872 CTGCTCTGCGTGCTGTGTTCAGG + Intergenic
967811613 3:193765712-193765734 CTGGGCTGCTGGCTGAGTCCAGG + Intergenic
967944050 3:194788208-194788230 CTATTCTGCCTGCTGTGCACTGG - Intergenic
968045131 3:195619706-195619728 CTGTGGTGCCGGCTGTGGACAGG - Intergenic
968060986 3:195726043-195726065 CTGTGGTGCCGGCTGTGGACAGG - Exonic
968121306 3:196127975-196127997 CTGTCCTGGCTGCTCTGTGCTGG - Intergenic
968396533 4:243630-243652 CTGTGCTGCCTGCTGTGGCAGGG - Intergenic
968500797 4:949004-949026 CTGTGCTGCTTGCTGCCTGCTGG - Intronic
968516482 4:1017741-1017763 CTGTGCTGAGGGCTGTGTTCTGG + Intronic
968667989 4:1831654-1831676 CTGGGGTGCCTGTTGTGTCCCGG + Intronic
969001197 4:3983771-3983793 CAGTGCTGCCTGCTGTGGCAGGG + Intergenic
969058679 4:4417972-4417994 CTGTGCTGACTCCTGAGTCGGGG + Exonic
969234476 4:5855895-5855917 CTCTGCAGCCTGCTGTGCCCAGG - Intronic
969273873 4:6121596-6121618 GTGTGCTCCCTGCTAGGTCCGGG - Intronic
969812722 4:9661098-9661120 CAGCGCTGCCTGCTGTGGCAGGG - Intergenic
971369342 4:26003298-26003320 CTGTCTTGACTGCTGTCTCCAGG + Intergenic
973975236 4:56256553-56256575 CTGAGCTGCCTACTGTGAACTGG + Intronic
975992304 4:80269156-80269178 CTGTGCGCGCTGCTGTCTCCTGG + Intronic
978115249 4:105012170-105012192 CTGTGATGCCTACTTTATCCAGG - Intergenic
978811945 4:112859494-112859516 TGCTGCTGCCTCCTGTGTCCAGG + Intronic
979271915 4:118772734-118772756 CAGTGATGTCTGGTGTGTCCTGG + Intronic
980487432 4:133476926-133476948 ATGTGCTGTCTACTGTTTCCAGG - Intergenic
981156648 4:141445022-141445044 CTGTGTGGCATGCTTTGTCCTGG + Intergenic
983885322 4:172974924-172974946 CTGTGGTTCCTGGTGTCTCCAGG - Intronic
983934336 4:173490437-173490459 CTGAGCTGCCTTCTGGTTCCTGG - Intergenic
985546196 5:510380-510402 CTGTGCTGGCCCCTGTCTCCAGG - Intronic
985706621 5:1405314-1405336 CTGTCCCACCTGCTGTGTGCAGG + Intronic
985706665 5:1405524-1405546 CTGTGCTGCCTGATCTGGGCAGG - Intronic
985725123 5:1512067-1512089 CTCTGCCACCTGCTGTGTCCTGG - Intronic
985780541 5:1868633-1868655 TGGTGCATCCTGCTGTGTCCAGG + Intergenic
985871262 5:2558903-2558925 CTGTGCTGGCCGCTGAGGCCGGG - Intergenic
985954323 5:3252004-3252026 ATGTGCTGCCTGCTTTGGCCCGG + Intergenic
985956442 5:3269302-3269324 CTCTGTTGACTTCTGTGTCCAGG + Intergenic
988381684 5:30504613-30504635 CTGTACTGCCTGCAGTTTTCAGG + Intergenic
990289474 5:54334053-54334075 GGGTGCTGGCTGCTGTGGCCAGG - Intergenic
990564089 5:57011751-57011773 CCAGGCTGCCTGCTGTGTGCAGG + Intergenic
990980510 5:61598637-61598659 GTCTGCTGCCTGCTTTGTACAGG + Intergenic
991975490 5:72180072-72180094 CTGTGCAGGCTGCTGTCGCCTGG + Intronic
992143784 5:73824814-73824836 CTGTGCAACCTGCTGGGCCCAGG - Intronic
994881188 5:105498507-105498529 CTGTGCTCTCTGCTGTGACAGGG + Intergenic
994881381 5:105501573-105501595 CTGTGCTCCCTGCTGTGACAGGG - Intergenic
995035471 5:107529483-107529505 TTGTGCTGCCTGGAGTGTCCAGG - Intronic
995938716 5:117551453-117551475 CTGTGCAGTCAGCTGTGGCCGGG + Intergenic
998037666 5:138930666-138930688 CTGTGCAGCCTGGTGGGGCCGGG - Intronic
999101469 5:149029109-149029131 CTGTGCTGGGAGTTGTGTCCTGG - Intronic
999752700 5:154641445-154641467 CTGTGCTGCCCGCTGTGGTGGGG + Intergenic
1001258042 5:170200201-170200223 CTGTGCTGGGTGCTCTGTCATGG + Intergenic
1002419918 5:179140099-179140121 CTCTGCAGCCTGCAGTGTCTGGG + Intronic
1002964794 6:1953143-1953165 CTGTGCTGCCGGCTGTTGGCAGG - Intronic
1003076585 6:2988434-2988456 CTCTGCAGCCTTCAGTGTCCTGG - Intronic
1003122179 6:3327308-3327330 CTTGGCTGGCAGCTGTGTCCCGG + Intronic
1003160008 6:3626392-3626414 CTTTGCTGCCTGCGGCATCCTGG + Intergenic
1005110789 6:22279892-22279914 TCCTGCTGCCTGCTGTGTCTGGG + Intergenic
1006276462 6:33008450-33008472 CTGTGCCGACTGCAGTGTGCTGG - Intronic
1006618714 6:35347422-35347444 TTTTGCTGCCTGTTGTGTCTAGG + Intronic
1006800603 6:36757288-36757310 CTGTGCTGCCTGTTGGTTTCTGG + Intronic
1006839200 6:37017600-37017622 CTCTGCTGGCTCCTGAGTCCTGG + Intronic
1007183332 6:39946610-39946632 CTGACCTTGCTGCTGTGTCCTGG + Intergenic
1007572074 6:42900079-42900101 CTGCGCTGCCTGCTGTGGCAGGG + Intergenic
1007686612 6:43670833-43670855 CTGCGCAGCCTGCTCTGGCCGGG + Exonic
1009490915 6:64289565-64289587 CTGTTATGCCTGCTTTGTGCTGG + Intronic
1013773674 6:113654594-113654616 CTGTGCTGCTGGCAGTGCCCTGG - Intergenic
1015230472 6:130909514-130909536 CTGTGCTGGCAGCTCTGGCCAGG + Intronic
1017566841 6:155696075-155696097 CTCTGCTGCCTACGTTGTCCAGG + Intergenic
1017686567 6:156919523-156919545 GTGTGTGGCCAGCTGTGTCCTGG + Intronic
1017886887 6:158607078-158607100 CTGAATTGCCTACTGTGTCCTGG - Intronic
1018434264 6:163746985-163747007 CTGTGCTGGCTGCAGAGTTCTGG + Intergenic
1018744928 6:166754632-166754654 GTGAGTTGCCTGCTGTGTCTGGG + Intronic
1018787477 6:167119274-167119296 CTGTGCTCCCTCCTGTGAACTGG + Intergenic
1019061240 6:169259693-169259715 CTGTGCTGTTTGCAGTGTCTGGG - Intergenic
1019316055 7:387472-387494 CTCTGGGCCCTGCTGTGTCCAGG + Intergenic
1019527950 7:1489255-1489277 CTGTGTTCCCTGCTGTCTCCTGG - Intronic
1019531019 7:1503608-1503630 CTGTGCTGCCTCCCGCCTCCTGG + Intronic
1019916101 7:4133691-4133713 GTGAGCTCCCTGCTGTGTCCTGG + Intronic
1020050598 7:5079143-5079165 CTTCTCCGCCTGCTGTGTCCTGG + Intergenic
1021593969 7:22294784-22294806 CTATGCTGGCTTCTGAGTCCAGG - Intronic
1022210575 7:28205017-28205039 CTGTTGTGCCTACTGTGTGCCGG - Intergenic
1022336335 7:29425325-29425347 GGGTGCTGCCAGCTGAGTCCCGG + Intronic
1022562381 7:31363280-31363302 CTGTGCTGCAGGCTGTGACGTGG + Intergenic
1024223032 7:47303162-47303184 CTGTGGTGGCTGCTGTGTCCAGG + Exonic
1027190436 7:75993204-75993226 CTGGGCTGCCTGCTTGGTCCAGG - Intronic
1027211225 7:76150382-76150404 CGGTGCTGCCTGCTGGGTCTTGG - Intergenic
1029017193 7:97326795-97326817 CTATGCTGAGTGCTGAGTCCAGG - Intergenic
1029346313 7:99981132-99981154 CTGTGGTTCCTGCTCCGTCCTGG - Intergenic
1029382273 7:100221836-100221858 CTGGGCTCCCTGCTGTGGCCTGG + Intronic
1029402434 7:100354285-100354307 CCGGGCTCCCTGCTGTGGCCTGG + Intronic
1033424823 7:141234543-141234565 CAGGGCTGTCTTCTGTGTCCAGG + Intronic
1033474184 7:141674866-141674888 CGGTGCTGCCTTCTGGGTTCTGG - Intronic
1033811252 7:145014700-145014722 TTTTGCTGCCTTCTGTATCCAGG - Intergenic
1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG + Intergenic
1034959491 7:155356059-155356081 CTCTCCTGCCTGCGGTGTGCAGG + Intergenic
1035237550 7:157508690-157508712 CTGAGCTGCGTGCTGTCTGCAGG + Intergenic
1035357536 7:158285537-158285559 CTCAGCTGCCTGCTGTACCCAGG - Intronic
1035381877 7:158445703-158445725 CTATGCTGCCTGGTGGGGCCAGG + Intronic
1035534171 8:378530-378552 CTGTGCTGCCCGCTTCCTCCAGG + Intergenic
1035610475 8:959496-959518 TGGTGCTGTCTTCTGTGTCCAGG + Intergenic
1035625327 8:1066934-1066956 CTGGGCCGCCTGCTGCGACCAGG - Intergenic
1035656661 8:1313060-1313082 CTGTGCTGACTGGTGTGTGCCGG + Intergenic
1035700046 8:1631533-1631555 CCATCCTGCCGGCTGTGTCCTGG + Intronic
1036579229 8:10057200-10057222 ATTTGCAGCCTGCTGTGTTCAGG + Intronic
1037305300 8:17497515-17497537 CTGTGCAGCCGGCTCTGCCCGGG + Intronic
1037681377 8:21100527-21100549 CTGTGCTGACAGCAGTGTGCTGG + Intergenic
1039546456 8:38414372-38414394 CTGTTCTCCATGCTGTCTCCTGG - Intronic
1040518394 8:48153437-48153459 CTGTGCTCATTGCTGTTTCCAGG - Intergenic
1040789082 8:51204161-51204183 CTGAGCTGTCTGCTGTCTTCAGG - Intergenic
1041475336 8:58259213-58259235 CTGCGCTGTCTGCTGATTCCTGG + Intergenic
1042269503 8:66941126-66941148 CTCTGCGGCCTCCTGTGTCCTGG + Intergenic
1043479457 8:80638394-80638416 CTGAGCTCCCTGCGGTGGCCAGG + Exonic
1043812926 8:84765088-84765110 CTGTGCTGCCTGCAATTTCCTGG - Intronic
1044617291 8:94155445-94155467 CTGTGCTGCCTGCCTGGGCCCGG - Intronic
1045299493 8:100899063-100899085 CTGTGCTGGGTGCTGGGTGCTGG + Intergenic
1046723544 8:117650252-117650274 CTCAGGTGACTGCTGTGTCCTGG - Intergenic
1048586113 8:135775808-135775830 CAGTGCTGGATGCTGTGTTCAGG - Intergenic
1049298378 8:141855842-141855864 CTTAGCTGCCTGCAGTGACCTGG + Intergenic
1050618337 9:7426529-7426551 CCCTGCTGGCTGCTGTGGCCTGG + Intergenic
1050801579 9:9621825-9621847 GTGTGCTGCCTGTGGTGTTCTGG + Intronic
1051149152 9:14061822-14061844 CTGGGCTGCTGGCTGTTTCCTGG - Intergenic
1053104043 9:35395338-35395360 CAGTGCTGCCTGCAGTGCCAGGG + Intronic
1054496159 9:65825001-65825023 CTGTGCTGCCTGCCGGGGGCGGG - Intergenic
1054570501 9:66805451-66805473 CAGTGCTGCCTGCTGTCTGATGG + Intergenic
1056100430 9:83295726-83295748 CTGTGGTGGCTGCTATGCCCAGG + Intronic
1057301869 9:93891253-93891275 CTGCCCTGCCTCCTGTTTCCAGG - Intergenic
1057822047 9:98340065-98340087 CTTTGCCACCAGCTGTGTCCCGG + Intronic
1058942662 9:109828010-109828032 GTGTGCTGTGTGCTGTGTGCTGG + Intronic
1059188135 9:112295940-112295962 CTGGGCTGCATGCTGTGCACAGG - Intronic
1060859794 9:126945045-126945067 CTGGGCTGCCTCCTGTGGACAGG - Intronic
1061677065 9:132223441-132223463 CTCTGCAGCCTGTGGTGTCCAGG + Intronic
1061800930 9:133113087-133113109 CTATGCCACCTGCTCTGTCCAGG + Intronic
1062033704 9:134373366-134373388 CTGTGCCTGCTGCTGTGTGCCGG + Intronic
1062342632 9:136100546-136100568 GGGTGGTGCCTGCTGAGTCCTGG + Intergenic
1062508443 9:136890771-136890793 CCGGGCTGCCTGCCGTGTCCTGG + Intronic
1062596972 9:137303876-137303898 CTGGGCTGCCTGCTGGTCCCTGG + Intergenic
1187388865 X:18872853-18872875 GTGCGCTGTCTGCTGTGTCCCGG + Intergenic
1188113886 X:26221686-26221708 CTGTGGTGCCTTCTCTGTTCTGG - Intergenic
1190641665 X:52486106-52486128 CTGTGCTTCCTGGTCTCTCCAGG + Intergenic
1190646007 X:52526759-52526781 CTGTGCTTCCTGGTCTCTCCAGG - Intergenic
1190688074 X:52891797-52891819 CTGTGCAGCCTGCAGAGTTCAGG + Intronic
1190697908 X:52963995-52964017 CTGTGCAGCCTGCAGAGTTCAGG - Intronic
1192661273 X:73045258-73045280 CTCTCCTGCCTGCTTTGTTCTGG + Intergenic
1192784195 X:74321702-74321724 CTGTGCTGCAGGCTGTGTCCTGG - Intergenic
1192804427 X:74496611-74496633 CTGTGCTGCAGGCTGTGTCCTGG + Intronic
1193978271 X:88150300-88150322 CTGTTCTGCCCTCAGTGTCCTGG + Intergenic
1196550338 X:117016945-117016967 CTGTGCTGCCTGCTCTTGCAGGG + Intergenic
1196606126 X:117659103-117659125 CTTAACTGCCTGCTGTGTGCTGG + Intergenic
1197073438 X:122327043-122327065 CTGTGATGTGTGCTGTGTCATGG - Intergenic
1198448157 X:136739327-136739349 CTGTGCTACTTACTGTGTCCTGG + Intronic
1198981479 X:142402052-142402074 CTGTGCTTCATGCTGTGTAAAGG - Intergenic
1199672853 X:150161385-150161407 GTGTGCTGCCTGCTGGGCCCTGG - Intergenic
1200392301 X:155956368-155956390 CTGAGCTGCCTGCTGTGCAGTGG - Intergenic
1200752935 Y:6963727-6963749 CCGTGCTGCCTGCTGTGGCGGGG + Intronic
1202054374 Y:20814543-20814565 CTGTGCTTCCAGGTGTTTCCAGG - Intergenic
1202195962 Y:22298295-22298317 CTGGGCTTCCAGGTGTGTCCGGG - Intergenic