ID: 1143451043

View in Genome Browser
Species Human (GRCh38)
Location 17:7036832-7036854
Sequence ACTCAGGTATAGGTGGGTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143451043_1143451051 11 Left 1143451043 17:7036832-7036854 CCTTGACCCACCTATACCTGAGT 0: 1
1: 0
2: 0
3: 11
4: 297
Right 1143451051 17:7036866-7036888 GTCAGGTGAGAGCCTGCACAAGG 0: 1
1: 0
2: 2
3: 13
4: 204
1143451043_1143451050 -6 Left 1143451043 17:7036832-7036854 CCTTGACCCACCTATACCTGAGT 0: 1
1: 0
2: 0
3: 11
4: 297
Right 1143451050 17:7036849-7036871 CTGAGTATTGGGTTGCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 113
1143451043_1143451053 16 Left 1143451043 17:7036832-7036854 CCTTGACCCACCTATACCTGAGT 0: 1
1: 0
2: 0
3: 11
4: 297
Right 1143451053 17:7036871-7036893 GTGAGAGCCTGCACAAGGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 217
1143451043_1143451052 12 Left 1143451043 17:7036832-7036854 CCTTGACCCACCTATACCTGAGT 0: 1
1: 0
2: 0
3: 11
4: 297
Right 1143451052 17:7036867-7036889 TCAGGTGAGAGCCTGCACAAGGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143451043 Original CRISPR ACTCAGGTATAGGTGGGTCA AGG (reversed) Exonic
900163703 1:1236416-1236438 CCTCAGGTCTAAGGGGGTCACGG + Intergenic
900650906 1:3729731-3729753 ACTCTGGTCTTGGTGGGTCATGG - Intronic
906415168 1:45616175-45616197 AGACAGGCATAGGTGGGCCAGGG + Intronic
909268098 1:73588314-73588336 ACACAGGTATATGTGTGCCATGG + Intergenic
910223172 1:84909517-84909539 ACACAGGTATACGTGTGCCATGG - Intergenic
910560811 1:88588706-88588728 ACACAGGTATACGTGTGGCATGG - Intergenic
911369944 1:96984891-96984913 ACACAGGTATACGTGTGCCATGG + Intergenic
911970545 1:104429898-104429920 ACATAGGTATATGTGTGTCATGG - Intergenic
912099460 1:106188360-106188382 ACATAGGTATACGTGTGTCATGG + Intergenic
912769313 1:112448292-112448314 ACTCAGTTGTTGATGGGTCAAGG - Intronic
912797170 1:112700335-112700357 CCTCAGGTATGGCTGGGCCAGGG + Exonic
913025344 1:114832780-114832802 ACCCAGGTAGAGGTGGGGCCAGG + Intergenic
914932296 1:151945952-151945974 ACTCAGGGATGGGTGGGGAAAGG + Intergenic
916568227 1:166001483-166001505 ACACAGGTAAAGTTGTGTCATGG + Intergenic
917685328 1:177409893-177409915 ACACAGGTATACATGTGTCATGG - Intergenic
917890834 1:179436789-179436811 ACACAGGTATACGTGTGCCATGG - Intronic
918253750 1:182728933-182728955 ACACAGGTAAATGTGTGTCATGG - Intergenic
918885727 1:190191339-190191361 ACACAGGTATACGTGTGCCATGG + Intronic
918976212 1:191489819-191489841 ACACAGGTAAATGTGTGTCATGG + Intergenic
921533703 1:216317490-216317512 ACTTAGGTAAAGGTGTGCCATGG - Intronic
922198881 1:223384331-223384353 ACTGAAGTATAGGTTTGTCATGG - Intergenic
922584502 1:226723325-226723347 ACTCAGGTCCAGGTGGCTCTGGG - Intronic
923857378 1:237859473-237859495 ACACAGGTATATGTGTGCCATGG - Intergenic
924798223 1:247308458-247308480 ACCCAGGTAAAGAAGGGTCAGGG - Exonic
1063699216 10:8368488-8368510 ACACAGGTAAATGTGTGTCATGG - Intergenic
1066525713 10:36276807-36276829 ACATAGGTATATGTGTGTCATGG - Intergenic
1068147120 10:53086404-53086426 ACACAGGTATATGTGTGCCATGG + Intergenic
1068441602 10:57062509-57062531 ACATAGGTATACGTGTGTCATGG - Intergenic
1069190152 10:65477315-65477337 AGTCAGGTTTAGCTGTGTCATGG + Intergenic
1069356790 10:67596291-67596313 CCTCAGGTATAAATGGGTTAAGG - Intronic
1070624741 10:78042726-78042748 ACTCAGCTAGAGGTGGTTCTGGG + Intronic
1071211865 10:83350969-83350991 ACATAGGTATACGTGTGTCATGG + Intergenic
1072340353 10:94441635-94441657 ACACAGGTATACGTGTGCCATGG + Intronic
1072836044 10:98713468-98713490 ACTCTGGTTTCGGTGGGTGATGG - Intronic
1073180867 10:101582413-101582435 ACTGAGGTTAGGGTGGGTCAGGG - Intronic
1075120786 10:119663116-119663138 AGTCAGTTGTGGGTGGGTCAAGG + Intronic
1075178265 10:120185769-120185791 TTTCAGGTATAGGTGGATCTAGG + Intergenic
1075795790 10:125118619-125118641 ACTCAGGTACAGGTGTGTGGGGG - Intronic
1079965845 11:26978982-26979004 GCACAGGTATATGTGGGCCATGG + Intergenic
1080096069 11:28408250-28408272 ACTTAGGTAAACGTGGGTCATGG - Intergenic
1080322972 11:31036440-31036462 ACAGAGACATAGGTGGGTCAGGG - Intronic
1080602924 11:33838195-33838217 ACACAGGTATACGTGTGCCATGG + Intergenic
1081717156 11:45258529-45258551 TTTCAGGTATAGGTGAGTTAGGG + Intronic
1084588563 11:70077674-70077696 ACTCAGGCTTAGGAGGGCCAAGG - Intergenic
1086589757 11:88499633-88499655 ACGTAGGTATACATGGGTCATGG + Intergenic
1086769912 11:90749213-90749235 ACACAGGTATGTGTGTGTCATGG + Intergenic
1087307283 11:96501874-96501896 AATCAGGAATGGGTGGGTGAAGG - Intronic
1087701289 11:101439567-101439589 ACATAGGTAAAGTTGGGTCATGG - Intergenic
1088355033 11:108934101-108934123 ACTCAGATGAGGGTGGGTCAGGG + Intronic
1088780967 11:113133640-113133662 ACTCAGGTTTATGTGTGTGATGG + Intronic
1088810004 11:113385855-113385877 CTTCAGGTATAAGTGGATCAAGG + Intergenic
1090734879 11:129603229-129603251 ACATAGGTATAGGTGTGCCATGG - Intergenic
1090741405 11:129664539-129664561 ACATAGGTAAAGGTGTGTCATGG - Intergenic
1090846916 11:130537200-130537222 ACACAGGTAAACGTGTGTCATGG + Intergenic
1091231705 11:133991890-133991912 ACGCAGGTAAAGGTGTGCCATGG - Intergenic
1092076738 12:5680230-5680252 ACACAGGTAAAAGTGTGTCATGG - Intronic
1093142411 12:15524567-15524589 CCTCAGGTACAGATGGGTCTGGG + Intronic
1093914279 12:24783493-24783515 ACACAGGTATACGTGTGCCATGG - Intergenic
1095578885 12:43771946-43771968 CCTCTGATATAGGTGGCTCATGG + Intronic
1095682639 12:44996829-44996851 ACATAGGTATATGTGTGTCACGG + Intergenic
1095990705 12:48032657-48032679 CCTCAGGACTAGGTGGGCCAAGG - Intergenic
1097862264 12:64529639-64529661 ATTCAGGTATGGCTGGGTCCAGG - Intergenic
1098263731 12:68697564-68697586 ACACAGGTAAAGGTGTGCCATGG - Intronic
1100303122 12:93326065-93326087 ACTTATGAATAGGTGAGTCACGG - Intergenic
1100914375 12:99402364-99402386 ACATAGGTAAAGGTGTGTCATGG + Intronic
1101065750 12:101018665-101018687 ACACAGGTATGTGAGGGTCATGG - Intronic
1103032672 12:117630011-117630033 ACTCATGCAGAAGTGGGTCATGG + Intronic
1103064489 12:117885782-117885804 ACATAGGTATATGTGTGTCATGG - Intronic
1104496803 12:129248604-129248626 ACACAGGTAGACTTGGGTCATGG + Intronic
1105467904 13:20664198-20664220 ATTCAGGTTTATGTGGGTCAGGG + Intronic
1107205107 13:37775459-37775481 ACACAGGTAAACGTGTGTCACGG + Intronic
1108673978 13:52720763-52720785 AGTCAGGCACAGGGGGGTCAGGG + Intronic
1109462105 13:62674272-62674294 ACACAGGTAAACGTGTGTCATGG - Intergenic
1109597703 13:64578084-64578106 ACACAGGTATACGTGTGCCATGG - Intergenic
1109635861 13:65115033-65115055 ACACAGGTAAATGTGTGTCATGG - Intergenic
1110023292 13:70503445-70503467 ACACAGGTATACGTGTGCCATGG + Intergenic
1111200582 13:84929978-84930000 ACACAGGTATATGTGTGCCATGG - Intergenic
1111329455 13:86745466-86745488 ACACAGGTATACATGTGTCATGG + Intergenic
1112613676 13:100981518-100981540 ACTTAAGCATAGGTGGGCCAGGG + Intergenic
1114288123 14:21265050-21265072 ATTCATGTATAGTTGGCTCAAGG - Intronic
1114396522 14:22367704-22367726 ACATAGGTATAGGTGTGCCACGG - Intergenic
1114427197 14:22633893-22633915 CCTCAGGGATGTGTGGGTCAGGG - Exonic
1115640808 14:35334537-35334559 ACTCAGGAGTATGTGAGTCAAGG + Intergenic
1116296439 14:43118057-43118079 CCACAGCTGTAGGTGGGTCAAGG - Intergenic
1116995353 14:51318313-51318335 GCTCAGGTATAGGGGTTTCAGGG - Intergenic
1117426882 14:55609084-55609106 ACATAGGTATATGTGTGTCATGG + Intronic
1118528087 14:66668728-66668750 ACACAGGTAAACGTGTGTCATGG - Intronic
1120320690 14:82956788-82956810 ACACAGGTATATGTGTGCCATGG + Intergenic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122134544 14:99625276-99625298 GCTAAGGTGTAGGGGGGTCAAGG + Intergenic
1202895552 14_GL000194v1_random:6043-6065 ACACAGGTATACATGTGTCACGG - Intergenic
1125399994 15:39291833-39291855 ACTTAGGTAAACGTGTGTCATGG + Intergenic
1129233997 15:74212922-74212944 TCTCAGGCCTAGGTGGGGCATGG + Intergenic
1130031270 15:80316720-80316742 ACTGAGGAACAGGTGGGTGAAGG - Intergenic
1130788535 15:87126572-87126594 ACTCAGGTAGTGGGGGGTCCTGG + Intergenic
1132206816 15:99992119-99992141 ACACAGGTATACATGTGTCATGG - Intronic
1132260035 15:100415889-100415911 ACATAGGTATATGTGTGTCATGG - Intronic
1133614170 16:7460662-7460684 ACACAGGTAAACGTGTGTCATGG - Intronic
1134259643 16:12640666-12640688 AATCAGCTATAGGTAGGGCAGGG - Intergenic
1134833570 16:17343368-17343390 ACTCAGGCATAGGTGGGCTTGGG + Intronic
1135604143 16:23808686-23808708 ACATAGGTAAAGGTGTGTCATGG - Intergenic
1138673795 16:58636364-58636386 ACACAGGTATACGTGTGCCATGG - Intergenic
1140529558 16:75652463-75652485 AATCAGGTGAAGGTGGGTGATGG - Intronic
1140602705 16:76497772-76497794 ACTCAGGTATACACGGGCCATGG - Intronic
1142922811 17:3205940-3205962 ACATAGGTATATGTGTGTCATGG - Intergenic
1143118562 17:4593886-4593908 ACACAGCAATAGGTGAGTCAGGG + Exonic
1143451043 17:7036832-7036854 ACTCAGGTATAGGTGGGTCAAGG - Exonic
1143991853 17:10971394-10971416 ACACAGGTAAATGTGTGTCATGG - Intergenic
1144166595 17:12617472-12617494 ACACAGGTATATGTGTGCCATGG + Intergenic
1146552038 17:33788961-33788983 ACATAGGTATACGTGTGTCATGG - Intronic
1147172245 17:38628847-38628869 ATTCAAGTATAGCTGGGTCCAGG - Intergenic
1148342321 17:46880736-46880758 ACACTGGTATAGGTCGGGCAGGG + Intronic
1150254634 17:63734350-63734372 AATCAGGGATAGGTTGGGCACGG + Intronic
1151145393 17:72035718-72035740 CCTCAGGCATAAATGGGTCAAGG - Intergenic
1151503800 17:74512773-74512795 ACTAAGGTTTAGGTTGGTGAGGG + Intergenic
1156239959 18:35243570-35243592 TTTCAGGTCTAGGTGGGTGATGG + Intronic
1156396281 18:36703045-36703067 ACAGAGGTATAGGGAGGTCATGG + Intronic
1156441914 18:37199144-37199166 ACACAGGTAAACGTGTGTCATGG + Intronic
1156913484 18:42438726-42438748 ACACAGGTAAAGGTGTGCCATGG + Intergenic
1157567328 18:48688394-48688416 GCTCAGGTATAGGGGTGCCAAGG + Intronic
1158034772 18:53013638-53013660 ACACAAGTATACGTGTGTCATGG - Intronic
1158317623 18:56228987-56229009 ACATAGGTATACGTGTGTCATGG + Intergenic
1160081734 18:75734294-75734316 ACACAGGTAAATGTGTGTCACGG + Intergenic
1163163401 19:15479300-15479322 ACCCAGGGACAGGTGAGTCAGGG - Exonic
1163227314 19:15973398-15973420 ACACAGGTAAATGTGTGTCATGG + Intergenic
1165044196 19:33091689-33091711 ACACAGGTAAATGTGTGTCATGG - Intronic
1165828701 19:38719955-38719977 AGTCAGGTAGGGGTGGGGCAGGG - Intronic
1166239128 19:41477851-41477873 ACTCAGGTTTAATTGGCTCATGG - Intergenic
1166241411 19:41497056-41497078 ACTCAGGTTTAATTGGGTCATGG - Intergenic
1166263725 19:41663097-41663119 ACTTAGGTATAAATGTGTCATGG - Intronic
1168033534 19:53700717-53700739 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168038087 19:53736355-53736377 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168046186 19:53795939-53795961 GGTCAGGTAAAGGTCGGTCAAGG + Exonic
925511986 2:4638157-4638179 ACATAGGTATATGTGTGTCATGG - Intergenic
926913116 2:17869714-17869736 ACTGAGGCACAGGTGGGCCAAGG + Intergenic
933076511 2:77934125-77934147 ACTTAGGTATATGTGTGCCATGG - Intergenic
936662595 2:114559060-114559082 CCTCAGGTGTATGTGGGACATGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936736980 2:115456898-115456920 ACACAGGTATAGATGTGCCATGG - Intronic
939868683 2:147503854-147503876 ACTGAGGTGGAGGTGGGACAGGG - Intergenic
940272769 2:151909502-151909524 ACACAGGTATATGTGTGCCATGG + Intronic
940308698 2:152254078-152254100 ACTCAGGTACAGGGAGTTCAAGG - Intergenic
940687611 2:156873215-156873237 ACACAGGTATACATGGGCCATGG - Intergenic
942391085 2:175493765-175493787 ACACAGGTATATGTGTGCCATGG + Intergenic
943978340 2:194512101-194512123 ACATAGGTATATGTGTGTCATGG + Intergenic
946431465 2:219629000-219629022 ACACAGGTGTTGGGGGGTCATGG + Intronic
946713196 2:222526919-222526941 ACACAGGTATACGTGTGCCATGG - Intronic
1172878269 20:38179676-38179698 ACATAGGTATACGTGTGTCATGG - Intergenic
1173319190 20:41972260-41972282 AGTCAGGTCTTGGTGGGTCCTGG + Intergenic
1173423257 20:42921804-42921826 ACTCAGCTACATGAGGGTCATGG - Intronic
1173945742 20:46949505-46949527 GTTCAGGTATAGCTGGATCAGGG + Intronic
1174483588 20:50847750-50847772 ATTCAGTTACAGGTGGGACACGG + Intronic
1174780066 20:53381703-53381725 ACTCAGGTAGGGATGAGTCAAGG + Intronic
1175853579 20:62106984-62107006 GCACAGGTATGGGTGGGCCAAGG - Intergenic
1176615246 21:9022049-9022071 ACACAGGTATACATGTGTCACGG - Intergenic
1176709945 21:10141837-10141859 ACACAGGTATACATGTGTCATGG + Intergenic
1177766942 21:25469514-25469536 ACATAGGTATAGCTGTGTCATGG + Intergenic
1177861073 21:26454813-26454835 ACACAGGTATACGTGTGCCATGG + Intergenic
1178320299 21:31600187-31600209 ACTATTGTATAGGTGGGGCACGG + Intergenic
1178752186 21:35315506-35315528 ACACAGGTATACGTGTGCCATGG - Intronic
1179635957 21:42709393-42709415 ACACAGGTAAACGTGTGTCATGG - Intronic
1183241736 22:36662665-36662687 ACTCAGGTATAGGTAAGCCCAGG - Intronic
1184512732 22:44942825-44942847 ACTCAGGTCCAGCTGGGGCAAGG - Intronic
1185148195 22:49150463-49150485 ACTCAGGGAGGGTTGGGTCATGG + Intergenic
949183824 3:1166981-1167003 ACACAGGTATACATGTGTCATGG - Intronic
949474462 3:4430531-4430553 AGTTAGGTATATGTGGGTAATGG + Intronic
951238769 3:20265913-20265935 ACACAGGTATACATGTGTCATGG + Intergenic
954559000 3:51539668-51539690 AATCAGCTTTATGTGGGTCATGG + Intergenic
956633177 3:71336320-71336342 ACACAGGTATACGTGTGCCATGG + Intronic
958677368 3:97282927-97282949 ACACAGGTAAATGTGTGTCATGG - Intronic
959025978 3:101239997-101240019 ACACAGGTATACGTGTGCCATGG - Intronic
959185162 3:103037637-103037659 AATCAGTTATAGGTGACTCAGGG - Intergenic
959222742 3:103542547-103542569 ACACAGGTATACATGTGTCATGG + Intergenic
959338168 3:105093221-105093243 ACACAGGTAAACGTGTGTCATGG - Intergenic
959712977 3:109403242-109403264 AATCAGGTTTACGTGGGGCAAGG - Intergenic
960187943 3:114667088-114667110 CCTCAGGCATAGATGGGTTAAGG - Intronic
965210600 3:165781687-165781709 ACATAGGTATACGTGTGTCATGG - Intronic
965621374 3:170645164-170645186 ACACAGGTATACGTGTGCCATGG + Intronic
967802547 3:193679182-193679204 ACACAGGTATACGTGTGCCATGG - Intronic
967969495 3:194988518-194988540 ACACAGGTACAGGAGAGTCAGGG - Intergenic
970044326 4:11833469-11833491 ACACAGGTATACGTGTGTTATGG + Intergenic
970113765 4:12669630-12669652 ACACAGGTAAAGGTGTGCCATGG - Intergenic
970226477 4:13863641-13863663 ACTCAGGTTTAATTGGATCAAGG - Intergenic
970321154 4:14876875-14876897 ACACAGGTAAATGTGTGTCATGG - Intergenic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
970896927 4:21114760-21114782 ACTCAGGTGTAGGAAGGTTAAGG + Intronic
971999946 4:34018996-34019018 ACACAGGTATACGTGTGTCATGG + Intergenic
972524689 4:39896963-39896985 ACACAGGTATACATGTGTCATGG + Intronic
972802417 4:42490774-42490796 ACTCAGGGAAAGTAGGGTCAAGG - Intronic
972932965 4:44097772-44097794 ACACAGGTATACGTGTGCCATGG - Intergenic
973018149 4:45167201-45167223 ACACAGGTATACGTGCGCCATGG + Intergenic
974931684 4:68367090-68367112 ACACAGGTATATGTGTGCCATGG - Intergenic
976074249 4:81278788-81278810 ACACAGGTATACATGTGTCATGG + Intergenic
976243816 4:82987462-82987484 ACACAGGTATACGTGTGCCATGG + Intronic
976687062 4:87825749-87825771 ACGCAGGTAAATGTGTGTCATGG + Intronic
977191647 4:94008346-94008368 ACACAGGTAAACGTGTGTCATGG - Intergenic
977646863 4:99422561-99422583 ACACAGGTATACGTGCGCCATGG - Intronic
978356041 4:107875606-107875628 ACACAGGTATATGTGTGTCATGG - Intronic
978464579 4:108994670-108994692 AGTCAGGTACACGGGGGTCAGGG - Intronic
978465756 4:109006999-109007021 ACACAGGTAAACGTGTGTCATGG - Intronic
979745986 4:124213680-124213702 ACACAGGTAAACTTGGGTCACGG + Intergenic
980665542 4:135929067-135929089 ACATAGGTAAAGGTGTGTCATGG + Intergenic
981658570 4:147140356-147140378 AATCAGGTTTAGTTGGCTCATGG + Intergenic
981779100 4:148405555-148405577 ACTCAGGTATAAGTAGTTCAAGG - Intronic
982101075 4:151968670-151968692 ACTCAGGTCACCGTGGGTCATGG - Intergenic
983586086 4:169356249-169356271 ACACAGGTAAACGTGTGTCATGG - Intergenic
986183302 5:5414326-5414348 ACACAGGTATACTTGGGCCATGG - Intergenic
987831159 5:23096903-23096925 ACACAGGTAAACTTGGGTCATGG - Intergenic
988608090 5:32699350-32699372 ACATAGGTATACGTGTGTCATGG + Intronic
989489497 5:42033438-42033460 ACACAGATATACGTGTGTCATGG + Intergenic
990974248 5:61543827-61543849 GCTCAGGTTGAGATGGGTCATGG - Exonic
991199135 5:63970720-63970742 ACATAGGTATAGGTGTGCCATGG + Intergenic
994277891 5:97861118-97861140 ACTTAGGTAAACGTGTGTCATGG - Intergenic
994502986 5:100603691-100603713 ACACAGGTATATGTGTGCCATGG + Intergenic
994579359 5:101619183-101619205 TTTCAGGTAGAGGTGGGTGAAGG - Intergenic
995468860 5:112479115-112479137 ACTCAGGTTGAGGTGGGAGAGGG + Intergenic
995826354 5:116304073-116304095 CCTCAGGTAGAGGTTGATCAGGG + Intronic
997051273 5:130383479-130383501 ACACAAGTATATGTGTGTCATGG - Intergenic
997841338 5:137243151-137243173 GCTCAGTTGTAGGTGGGACAAGG - Intronic
998073722 5:139219148-139219170 ACCCAGAGATAGGTGGGTCCAGG - Intronic
998905526 5:146900682-146900704 ACTTAGGTAAATGTGTGTCACGG + Intronic
999135203 5:149314093-149314115 ACTGAGGCAGAGGTGGGCCAAGG + Intronic
999689715 5:154136207-154136229 ACCCAAGTATAGTTCGGTCAAGG - Intronic
999722973 5:154412510-154412532 ACTCAGGTGCAGGTGGTCCAGGG - Intronic
1001294261 5:170488022-170488044 ACTCAGTTTGAGGTGGGACAGGG - Intronic
1003803006 6:9692904-9692926 ACTAAGGTATAAGTGTGCCACGG + Intronic
1003973570 6:11322273-11322295 ACACAGGTATACGTGTGCCATGG - Intronic
1004112447 6:12732409-12732431 ACATAGGTATACGTGTGTCATGG + Intronic
1005254245 6:23982996-23983018 ACTAAGGGATAGGTAAGTCAGGG - Intergenic
1006728295 6:36215831-36215853 ACTTAGGTCTTGGTGGGTTAGGG + Intronic
1008467697 6:51848985-51849007 ACACAGGTATACGTGTGCCATGG + Intronic
1009916195 6:69999946-69999968 ACATAGGTATACGTGTGTCATGG + Intronic
1011217564 6:85021031-85021053 ACATAGGTATAGGTGTGCCATGG - Intergenic
1011290224 6:85769189-85769211 ACATAGGTATACGTGGGTCACGG - Intergenic
1011990396 6:93508509-93508531 ACATAGGTAAAGGTGTGTCATGG + Intergenic
1012434277 6:99198490-99198512 ACACAGGTATACGTGTGCCATGG + Intergenic
1012573231 6:100758302-100758324 ACACAGGTATATGTGTGCCACGG + Intronic
1016274275 6:142330285-142330307 ACACAGGTAAATTTGGGTCACGG - Intronic
1021575400 7:22101565-22101587 ACATAGGTATATGTGTGTCATGG - Intergenic
1021846294 7:24766365-24766387 ACACAGGTATACATGTGTCATGG + Intergenic
1021949981 7:25765217-25765239 CTTCAGGTGTAGGTGGGTCCAGG - Intergenic
1022980054 7:35595838-35595860 GCTCAGGTTGAGTTGGGTCATGG - Intergenic
1023599946 7:41872313-41872335 ACACAGTTATATGTGGGTTAGGG - Intergenic
1023659565 7:42458339-42458361 ACTCAGGCATAGGTAGGGCAAGG + Intergenic
1025754473 7:64323822-64323844 ACACAGGTAAATGTGTGTCATGG - Intronic
1026120857 7:67536048-67536070 ACACAGGTATACATGTGTCATGG + Intergenic
1026299555 7:69085175-69085197 ACACAGGTATACGTGTGCCATGG - Intergenic
1029200657 7:98837069-98837091 ACTCTGGGATAGGTGGGCCTCGG + Intergenic
1029849609 7:103448060-103448082 ACACAGGTAAACGTGTGTCATGG - Intergenic
1031436832 7:121742669-121742691 ACACAGGTAAACGTGTGTCATGG + Intergenic
1031961632 7:127995345-127995367 AGTCAGCTGTATGTGGGTCAGGG - Intronic
1032750051 7:134830456-134830478 ACACAGGTAAATGTGTGTCACGG + Intronic
1033798601 7:144875740-144875762 ACACAGGTAAATGTGTGTCATGG + Intergenic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1036063482 8:5352272-5352294 ACATAGGTATACATGGGTCATGG - Intergenic
1037994442 8:23342157-23342179 ACTCAGGTCTAGGTGGTACAGGG - Intronic
1040852889 8:51920221-51920243 TCCCGGGGATAGGTGGGTCAAGG - Intergenic
1042505628 8:69556813-69556835 ACACAGGTAAACGTGTGTCATGG + Intronic
1045590280 8:103585825-103585847 ACACAGGTATACATGTGTCATGG - Intronic
1045712405 8:105000221-105000243 ACACAGGTATACGTGTGACATGG - Intronic
1045716683 8:105055343-105055365 ACAGAGGTAAATGTGGGTCATGG + Intronic
1045730122 8:105228319-105228341 ACTCAGGTCTAGGTGAATGATGG - Intronic
1046890227 8:119414750-119414772 ACACAGGTAAATGTGTGTCATGG + Intergenic
1048587148 8:135784931-135784953 ACACAGGTATACGTGTGCCATGG + Intergenic
1048945289 8:139441382-139441404 ACATAGGTAAAGGTGTGTCATGG - Intergenic
1050080274 9:1908595-1908617 ACACAGGTAAACGTGGGCCATGG - Intergenic
1050853887 9:10325049-10325071 ACTCAGGTCCAGGTGGCTCTAGG + Intronic
1051003079 9:12309573-12309595 ACACAAGTATATGTGTGTCATGG + Intergenic
1051035605 9:12741354-12741376 ACATAGGTATACGTGTGTCATGG + Intergenic
1052369846 9:27651634-27651656 ACACAGGTATACATGTGTCATGG - Intergenic
1053646922 9:40127531-40127553 ACACAGGTATACATGTGTCATGG + Intergenic
1053758803 9:41336311-41336333 ACACAGGTATACATGTGTCATGG - Intergenic
1054327926 9:63725497-63725519 ACACAGGTATATATGTGTCATGG + Intergenic
1054889193 9:70233179-70233201 AGTCAGGTACATGGGGGTCATGG - Intergenic
1055726169 9:79231626-79231648 ACATAGGTATATGTGTGTCATGG - Intergenic
1056497311 9:87171085-87171107 ACTCAGCTATAGGCGGGGCGCGG + Intergenic
1056823245 9:89859378-89859400 ACGCAGGTATAGGTGCCCCAGGG + Intergenic
1059947715 9:119428906-119428928 ACCTAGGTATACATGGGTCATGG - Intergenic
1059997767 9:119929459-119929481 ACACAGGTAAACGTGTGTCATGG - Intergenic
1061039711 9:128132905-128132927 ACGCAGGTATAGGTGCCCCAGGG - Intergenic
1202794708 9_KI270719v1_random:110834-110856 ACACAGGTATACATGTGTCATGG + Intergenic
1203634306 Un_KI270750v1:96851-96873 ACTCAGGGTTAAATGGGTCAAGG - Intergenic
1186009691 X:5115765-5115787 ACACAGGTAAAAGTGTGTCATGG + Intergenic
1186366136 X:8895558-8895580 ACATAGGTATATGTGTGTCATGG - Intergenic
1186455049 X:9704111-9704133 TCTCAGGTCCAGGTGGTTCAGGG - Intronic
1187152867 X:16697220-16697242 ACTGAGCTATACGTGGCTCAGGG + Intronic
1187478752 X:19635477-19635499 ACACAGGTATATGTGTGCCATGG - Intronic
1187600227 X:20821048-20821070 ACATAGGTATATGTGTGTCATGG - Intergenic
1189051399 X:37649512-37649534 ACATAGGTATACGTGTGTCATGG - Intronic
1189107348 X:38251012-38251034 ACACAGGTATACGTGTGCCATGG + Intronic
1189574323 X:42335369-42335391 ACCTAGGTATATGTGTGTCATGG + Intergenic
1191143664 X:57141844-57141866 ACATAGGTATATGTGTGTCATGG + Intergenic
1191163416 X:57360721-57360743 ACATAGGTATAGGTGTGCCATGG + Intronic
1191966105 X:66760236-66760258 ACTCTGGTTTAAGTAGGTCAGGG - Intergenic
1192857684 X:75031302-75031324 ACTCAGGTATACATGTGCCATGG + Intergenic
1193113182 X:77750575-77750597 ACACAGGTATAGATGTGCCATGG + Intronic
1193623725 X:83790142-83790164 ACTTAGGTATACATGTGTCATGG - Intergenic
1194889372 X:99358297-99358319 ACACAGGTAAATGTGTGTCATGG - Intergenic
1195671193 X:107471389-107471411 ACATAGGTATAGGTGTGCCATGG + Intergenic
1195797185 X:108663678-108663700 ACACAGGTAAACGTGTGTCATGG - Intronic
1196038700 X:111176432-111176454 ACTTAGGTATATGTGTGCCATGG - Intronic
1196128371 X:112124735-112124757 ACATAGGTATAGGTGTGCCATGG - Intergenic
1196231581 X:113229928-113229950 ACACAGGTAAATGTGTGTCATGG + Intergenic
1196307999 X:114127270-114127292 AGTCAGGTACACGGGGGTCAAGG + Intergenic
1197045882 X:121998127-121998149 ACACAGGTATATGTGTGCCATGG + Intergenic
1198195298 X:134354683-134354705 ACACAGGTAAATGTGTGTCATGG + Intergenic
1201321188 Y:12699995-12700017 ACTCAGGTATAGCTGTGCAACGG + Intergenic
1201918732 Y:19210749-19210771 AGTCAGGAACAGGTGGGACATGG - Intergenic
1202026167 Y:20526104-20526126 ACACAGGAATAGGAGGGGCAAGG + Intergenic