ID: 1143452381

View in Genome Browser
Species Human (GRCh38)
Location 17:7043560-7043582
Sequence CTGTGCTTCCGCTGGGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143452374_1143452381 21 Left 1143452374 17:7043516-7043538 CCGTCTGCGGGGTGGGGAAACAT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1143452381 17:7043560-7043582 CTGTGCTTCCGCTGGGGAGCTGG 0: 1
1: 1
2: 4
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143452381 Original CRISPR CTGTGCTTCCGCTGGGGAGC TGG Exonic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
900264164 1:1749072-1749094 CTGGGCTCCCGCTGGGGAGGAGG + Intergenic
900640452 1:3685794-3685816 CTGTGCTGGGGCTGGGGACCTGG + Intronic
901040290 1:6359381-6359403 CTTTGCTTCAGCCAGGGAGCTGG - Intronic
901123361 1:6912612-6912634 CTGTCCCTCCGCAGGGGAGGAGG + Intronic
901637682 1:10677919-10677941 CTTTGCTTCCCCTGGAGAACGGG - Intronic
901961256 1:12828345-12828367 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901967849 1:12882950-12882972 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901975653 1:12942080-12942102 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901983247 1:13053215-13053237 CAGTGCTTTCCCTGAGGAGCTGG + Intronic
901985762 1:13074117-13074139 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
901996047 1:13152650-13152672 CAGTGCTTTCCCTGAGGAGCTGG + Intergenic
901998842 1:13175703-13175725 CAGTGCTTTCCCTGAGGAGCTGG - Intergenic
902009521 1:13259685-13259707 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
902017327 1:13318830-13318852 CAGTGCTTTCCCTGAGGAGCTGG - Intronic
903316608 1:22512811-22512833 CTGTGCTTCCTCTGGAGGCCTGG + Intronic
903692783 1:25186027-25186049 CTGTGTTTGCTCTGGGGGGCTGG - Intergenic
906152206 1:43594120-43594142 CTGTGCTGCAGCTGGGGGCCAGG - Intronic
907022831 1:51086046-51086068 CAGTGCTGCCCCTGAGGAGCAGG - Intergenic
919945912 1:202318859-202318881 CTATGCTGCGGCCGGGGAGCTGG + Exonic
921110813 1:212035198-212035220 CTGTGCTTTTGCTGGGGCGTGGG - Intronic
921957532 1:220999834-220999856 CTGTACTTTCTCTGGGGAGGTGG - Intergenic
922891167 1:229062784-229062806 CTGTGCTTCCCATGGGCTGCAGG + Intergenic
1064491246 10:15859946-15859968 CTGCCCTTCGGCTGGGGAGGAGG - Intronic
1065083162 10:22147163-22147185 CTCTGCTTCCCTTGGTGAGCCGG - Intergenic
1065969025 10:30791232-30791254 TTCTGCCTCCGCTGGGGAGGGGG + Intergenic
1067027783 10:42859075-42859097 CTGTCCTTGGGCTGGGGAGGAGG - Intergenic
1067754944 10:48998514-48998536 CTGTGTTTCCCATGGGGAGAAGG - Intergenic
1069564161 10:69451957-69451979 CTGTGCGTCCGCTGGCCGGCTGG + Intronic
1069729035 10:70599306-70599328 CTGTGCTTGTGCTCTGGAGCCGG - Intronic
1069994587 10:72334757-72334779 CTGTGCTGCCGCAGGAGGGCAGG - Exonic
1070789729 10:79181881-79181903 CTCAGCTGCCGGTGGGGAGCCGG - Intronic
1071309898 10:84333236-84333258 ATCTGCTCCCACTGGGGAGCAGG + Intronic
1073328243 10:102654920-102654942 CTGTGCTACCAGTGGGGAACTGG + Intronic
1073603617 10:104871083-104871105 CCGTGGTTCCTCTGGGAAGCAGG - Intronic
1074492818 10:113954376-113954398 CTGTGCATTCTCTTGGGAGCTGG + Intergenic
1075468028 10:122666057-122666079 CTGGGCTCCCGCCTGGGAGCAGG + Intergenic
1075862130 10:125685836-125685858 CTGCGTTTCCTCTGGAGAGCTGG - Intergenic
1076908878 10:133377744-133377766 CAGGACCTCCGCTGGGGAGCTGG + Intergenic
1077080918 11:724411-724433 CTCTGGTTCCCCTGGGGTGCCGG + Intronic
1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG + Exonic
1080605834 11:33864307-33864329 AAGTGCTTCCCTTGGGGAGCGGG - Intronic
1080774060 11:35369442-35369464 TTTTGCTTCAGCTGGGGAGTGGG - Intronic
1083526377 11:63369902-63369924 CTGTGCTTCCCCTCTGCAGCAGG - Exonic
1083960743 11:66013566-66013588 CTCAGCTTGGGCTGGGGAGCTGG - Intergenic
1084121060 11:67069227-67069249 CTGGACTACAGCTGGGGAGCCGG - Intronic
1084736451 11:71108581-71108603 CTGGGCTTCCGCTGGAGGTCTGG - Intronic
1085085069 11:73661330-73661352 CTGTTCTTTGACTGGGGAGCAGG + Intronic
1088975857 11:114815978-114816000 CAGTGCTGGAGCTGGGGAGCTGG - Intergenic
1095957051 12:47813037-47813059 CTGTGCTTCCCCTGGGTCCCGGG - Intronic
1096972875 12:55681715-55681737 CTGTGCTTCCGCTGGGGCACTGG - Exonic
1101509863 12:105383243-105383265 CTGTGTTAGCGCTGGGGATCAGG - Intronic
1102668655 12:114598754-114598776 CTGTGCTTCTACTGGTGACCAGG - Intergenic
1104584372 12:130036196-130036218 CTCTGCTTCCACTGGAGATCAGG + Intergenic
1104745575 12:131208259-131208281 CTGAGCTTCCCCTGGGGTGTGGG + Intergenic
1104788767 12:131468850-131468872 CTGAGCTTCCCCTGGGGTGTGGG - Intergenic
1104827627 12:131724853-131724875 CTGTGCAGGGGCTGGGGAGCAGG + Intronic
1105292326 13:19060927-19060949 CTGAGCTTCCAGTGGGGACCTGG - Intergenic
1108436118 13:50403212-50403234 CTGTGCCTTTGCTGGGAAGCTGG + Intronic
1108508766 13:51136171-51136193 CTGTGCTCCCGTTGCTGAGCTGG + Intergenic
1110158150 13:72342854-72342876 CTGGGCTTCAGCTGGGGACTGGG + Intergenic
1112398319 13:99053744-99053766 TTGTGCTATCGCTGGGGACCAGG - Intronic
1112625288 13:101096999-101097021 CTGGGCTTCTGCTGGGATGCTGG - Intronic
1113226442 13:108164857-108164879 CTGTGTCTCCTCTAGGGAGCAGG + Intergenic
1113379206 13:109786995-109787017 TTGAGCTTCCGCCGGGGAGGGGG + Intergenic
1116821743 14:49633991-49634013 CTGCGCTTCCGCTCGCGAGGGGG - Exonic
1118609254 14:67527349-67527371 CTCTGTTTCAGCTCGGGAGCCGG + Intronic
1118683718 14:68269742-68269764 CTGAGCAACCGCTGGGGAACAGG - Intronic
1119502807 14:75145062-75145084 CTGGTCTGCTGCTGGGGAGCAGG + Intronic
1119901660 14:78265668-78265690 CTGTGCCTCTGCTGGGGTACTGG - Intronic
1120501887 14:85307837-85307859 CGGTGCCTCCGGTGAGGAGCTGG + Intergenic
1121466362 14:94117954-94117976 CTGGGCTTCAGCTGGGATGCAGG - Intergenic
1122424557 14:101598305-101598327 CTGTGTTTCGGCCGGGGAGGGGG + Intergenic
1123468245 15:20531584-20531606 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1123649871 15:22469480-22469502 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1123728562 15:23126794-23126816 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1123740272 15:23278299-23278321 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1123746726 15:23324259-23324281 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1124023445 15:25944302-25944324 CTCTGCTTCCTCTGGGCTGCTGG - Intergenic
1124278993 15:28347575-28347597 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1124532603 15:30520510-30520532 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1124766050 15:32487134-32487156 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1126113291 15:45187767-45187789 CTGGGCTTCCGCGGGGGGGGCGG - Intronic
1126258645 15:46659189-46659211 CTGGGCTTACCTTGGGGAGCAGG - Intergenic
1127958072 15:63870571-63870593 CAGTGCTTCGGAGGGGGAGCAGG - Intergenic
1128647662 15:69388913-69388935 GTGTGCTTCAGCTGGGGAGATGG - Intronic
1133586319 16:7199081-7199103 GTGTTCTTCCTCTGGGGAGGAGG - Intronic
1134136139 16:11677527-11677549 CTGTGCTTGCGGCAGGGAGCCGG + Exonic
1135492041 16:22917729-22917751 CTGTGCTTCCCCTGTGGATCTGG + Intergenic
1135555600 16:23433737-23433759 CCGTGATTACGCTGGGTAGCAGG - Intronic
1135991696 16:27222517-27222539 CTGTCCTTCAGCTGGGGAAGGGG - Intergenic
1136230454 16:28882754-28882776 CTGAGACTCCGCTGGGGAGGGGG - Intronic
1136410794 16:30075976-30075998 CTTTGCTTCCGCGGCGGGGCCGG + Exonic
1139485331 16:67252978-67253000 CAGTGCTCCCGCTGGGGTTCAGG + Intronic
1140439128 16:74973334-74973356 CTGTGCTCCAGCTGGGGTGATGG - Intronic
1142310597 16:89310306-89310328 GTGTGCTTCCTCTTGGTAGCAGG - Intronic
1142310888 16:89312890-89312912 CAGTGCTGCAGGTGGGGAGCTGG - Intronic
1143452381 17:7043560-7043582 CTGTGCTTCCGCTGGGGAGCTGG + Exonic
1145057596 17:19713797-19713819 CTGGGCTCCGGCTGGGGAGGTGG - Intronic
1145886501 17:28385529-28385551 CTGTGCTCCCACTGGAGACCTGG - Intronic
1146617955 17:34371665-34371687 CTTTGATTCCGCTGGGGAGCAGG - Intergenic
1147178898 17:38673052-38673074 CTTTGCTCCCACTGGGGTGCAGG + Exonic
1149686908 17:58541080-58541102 CTTTGCTCCCTCTGAGGAGCAGG + Intergenic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1152352824 17:79792934-79792956 CTGTGCTTCCTCTGGCGTGCAGG + Exonic
1152732222 17:81977905-81977927 CTGCGCTTCCGCTGGGGTCCCGG + Intronic
1152875202 17:82782469-82782491 CTGTGGTCCCTCTGAGGAGCGGG + Intronic
1155163907 18:23217863-23217885 CTGTGCCTCAGCTGCGAAGCAGG - Intronic
1160739652 19:680040-680062 CTGCGCCTGCGCTGGGGGGCGGG - Intronic
1160791722 19:926453-926475 ATTTCCTTCCGCTGGGGAGGGGG - Intronic
1163783618 19:19263078-19263100 CTGTGCTTTGGCAGGGGACCTGG + Intergenic
1165163481 19:33832753-33832775 CAGTGCTTCCGCTGTGGAGGGGG - Intergenic
1165373597 19:35425873-35425895 CTGGGCTGGAGCTGGGGAGCTGG + Intergenic
1167767257 19:51491743-51491765 CTCTCCTTCCTCTGGGGAGGGGG + Exonic
1168062032 19:53898549-53898571 GTGTGCTGGCGCTGGGGGGCCGG + Exonic
925274670 2:2640324-2640346 CTGTGGCTCCCCTGGGAAGCAGG + Intergenic
926365016 2:12125134-12125156 CTTTGCTTCCTCTGAGGAGCTGG + Intergenic
926590572 2:14735819-14735841 CTGTGCTGACGCTGGGAAGGTGG - Intergenic
927480571 2:23450644-23450666 CTCTGCTTTCACTGGGGACCTGG - Intronic
930018115 2:46984676-46984698 CTTTGCTTCTGCTGGGGGCCTGG + Intronic
932794507 2:74682745-74682767 CTGGGCTTCCTGTGGGGAGTGGG + Intronic
933902371 2:86859250-86859272 CTGTCCTTCCACTGGGGAATAGG - Intronic
936516158 2:113182811-113182833 CTGTGCTCCCTCTGGGCAGAGGG - Exonic
937771161 2:125722029-125722051 CTGTGCTCCCTCTGGGGCCCCGG - Intergenic
943223844 2:185144338-185144360 CTGTGCCTCCCCTGCTGAGCTGG - Intergenic
945048645 2:205802885-205802907 CAGTTCTGCCTCTGGGGAGCTGG - Intergenic
947816557 2:233041334-233041356 CTGTCCTTCCCCTGGGGATTTGG - Intergenic
948231348 2:236351650-236351672 CTGTGCTGGCCTTGGGGAGCAGG + Intronic
948260739 2:236602727-236602749 ATGTGCTTCCCCTGGGGTCCAGG - Intergenic
948650767 2:239442244-239442266 CTGTGCTCCCTCTGGGCATCAGG - Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948805128 2:240450651-240450673 CCGTGCTTCCTCTGGGGAGGAGG + Exonic
948872572 2:240810939-240810961 CAGTGCTACCCTTGGGGAGCAGG + Intronic
1170456927 20:16542084-16542106 CTCTGCCTCTGCTGGGGAGTTGG - Intronic
1170474149 20:16698288-16698310 CTGTGCTGCAGCTGAGGAGATGG - Intergenic
1171456626 20:25276127-25276149 CTGGGCTTGTGCTGGGGGGCTGG + Intronic
1171823211 20:29874263-29874285 CTGGGCTTCGGCTGGGGCGCGGG - Intergenic
1171896884 20:30816049-30816071 CTGGGCTTCGGCTGGGGCGCGGG + Intergenic
1173049962 20:39549868-39549890 CTGCCCCTCCTCTGGGGAGCTGG - Intergenic
1173409831 20:42800337-42800359 CTGGCCTTGCGCTGGGGAGCTGG + Intronic
1173751402 20:45479732-45479754 CTGTGATTCCATTTGGGAGCAGG + Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174518089 20:51108774-51108796 CTCTGCCTGTGCTGGGGAGCAGG + Intergenic
1175232354 20:57481933-57481955 CTGTGCGTCCTCTGGATAGCAGG + Intergenic
1175247661 20:57591450-57591472 CTGAGTTTTGGCTGGGGAGCAGG + Intergenic
1175462709 20:59165126-59165148 CTGTGCTTCCGCTGGGAAGCTGG + Intergenic
1175548774 20:59802075-59802097 CTGTGCTTCGACAGGAGAGCAGG + Intronic
1175852890 20:62103525-62103547 CGGTGCTAATGCTGGGGAGCGGG - Intergenic
1178843426 21:36156352-36156374 CGGGGCTTCGGCTTGGGAGCAGG - Intergenic
1179461077 21:41535834-41535856 CTGTGCTTCCTCTGGAAAACAGG - Intergenic
1180841276 22:18960009-18960031 CTCAGCCTCAGCTGGGGAGCCGG - Intergenic
1180875990 22:19175502-19175524 CTGTGCCTCTGCAGGGGACCAGG - Intergenic
1181026521 22:20130801-20130823 GGGTGCTTCCCCAGGGGAGCAGG + Intronic
1182000999 22:26919706-26919728 CTGTTCTTCCTCTGGAGAACAGG - Intergenic
1182015606 22:27037012-27037034 AAGTGCTTCAGCTGGGGCGCAGG + Intergenic
1182349768 22:29692712-29692734 CTCTCCTTCCAGTGGGGAGCAGG - Intronic
1182475332 22:30573955-30573977 CTTTGCTTCCTCTGGGGTACAGG + Intronic
1183060867 22:35335654-35335676 CTGTCCTTCCTCTGGGGAGCAGG + Intronic
1183535412 22:38398237-38398259 CTGCGCTTCCGCTGGCGGGAAGG - Intronic
1184352178 22:43951753-43951775 CTGTGCTCCCCCTGAGGACCTGG + Intronic
1185116392 22:48940610-48940632 CTGGGCGTCCTCTGGTGAGCTGG - Intergenic
953329894 3:42043785-42043807 CTGTGCCCCCTCTGGGGAGTTGG - Intronic
954787335 3:53103631-53103653 CTGTGCTCCCTCTGGGGTGAGGG - Intronic
955277450 3:57559734-57559756 CTGGGCTTCCAATGGGGAGGAGG + Exonic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962329365 3:134464049-134464071 CTGTGACTCCACTGGGGTGCTGG + Intergenic
964641895 3:158917293-158917315 CTATGCTTGCCCTGAGGAGCTGG - Intergenic
965600437 3:170448770-170448792 CTGTGCTCCTGATGGGGAGAAGG + Intronic
965793200 3:172411349-172411371 CTGCGCCTCGCCTGGGGAGCGGG + Intergenic
966820221 3:183918142-183918164 CTTTGCTTCCACTAGGGAGGTGG - Intergenic
968969235 4:3784800-3784822 CTGTGGCTGCACTGGGGAGCGGG - Intergenic
977919083 4:102624183-102624205 CTTTGCTTCAGCTGGGAGGCAGG - Intergenic
984944677 4:184961801-184961823 CTGGGCTAGGGCTGGGGAGCAGG - Intergenic
985444653 4:190015335-190015357 CTGGGCTTCGGCTGGGGCGCAGG - Intergenic
990032688 5:51281078-51281100 CTGTCCTGCAGCTGGGGAGAAGG + Intergenic
992082611 5:73249266-73249288 CTGGGCTTGTTCTGGGGAGCTGG + Intergenic
993567978 5:89498939-89498961 CTTGGCTTGCGCTGGGGAGTTGG + Intergenic
995737080 5:115312928-115312950 CTTAGCTTCCCCTGGGGACCTGG - Intergenic
996218173 5:120893627-120893649 CTGTGCTTCCGGCAGGGAGAAGG - Intergenic
996668059 5:126083878-126083900 CTGTGCTTGAGCTGAGGACCAGG - Intergenic
998227389 5:140337491-140337513 CTGTGCTTTCTCTGGGAAGGAGG + Intronic
998438414 5:142134541-142134563 CAGTGGTTCCCCTGGGGAGTGGG - Intronic
999441625 5:151605715-151605737 CAGAGCTTCTGCTGGGGAGGGGG + Intergenic
1000004068 5:157166759-157166781 CTGTAGTTCTGATGGGGAGCAGG - Intronic
1000637430 5:163660049-163660071 CTGTGTCTCAGCTGGGGAACAGG + Intergenic
1002001541 5:176199122-176199144 TTCTGCTTGCGCTGGGCAGCGGG - Intergenic
1002252799 5:177939857-177939879 TTCTGCTTGCGCTGGGCAGCGGG + Intergenic
1002925908 6:1605461-1605483 CTCTGAGTCCGCTGGGGACCTGG + Intergenic
1007376182 6:41458278-41458300 GTGGGGTTCCGCTGGGGAGCAGG + Intergenic
1011917325 6:92523869-92523891 CTGTGCTACTGCTTTGGAGCTGG + Intergenic
1013596825 6:111668094-111668116 CTGTGCTGGCGCTGGGAAGGAGG + Intronic
1014045250 6:116877215-116877237 CTGGGGCTCCGCTGGGGAACCGG + Intronic
1017811183 6:157984972-157984994 ATGTGCATCCGCAGCGGAGCAGG - Intronic
1019611735 7:1940181-1940203 CTGTGCTTCTCCTGGGAAGGAGG + Intronic
1020106732 7:5425686-5425708 CTGTAGCTCCGCTGGGGAGGAGG + Intergenic
1022480496 7:30740379-30740401 CTGTATTTCAGCTGGGGACCAGG - Intronic
1025017418 7:55450143-55450165 CTGAGCTTCCCCTTGGGAGTTGG + Intronic
1032521675 7:132550229-132550251 CTGCCCTTCCTCTAGGGAGCAGG + Intronic
1033790041 7:144780411-144780433 CTGGGATGCGGCTGGGGAGCTGG - Intronic
1035204930 7:157289160-157289182 CTGGGCTTCCACTGTGGAGCTGG + Intergenic
1035726943 8:1830658-1830680 ATGTGCTTGCCCTGGGGGGCTGG + Intronic
1036023122 8:4871015-4871037 CTGTGCTCACCCTGGGGAGCTGG + Intronic
1037709590 8:21345175-21345197 CTGTGCTTGCACGAGGGAGCTGG + Intergenic
1041328178 8:56692185-56692207 CTGAGCTTCCCCTGGGAACCGGG - Intergenic
1041931268 8:63289409-63289431 CTGTACTTCACCTGGAGAGCAGG + Intergenic
1042809021 8:72803803-72803825 CTGTGCTTCTTCTGGGCTGCTGG + Intronic
1044058450 8:87601709-87601731 CTGTCCTGTCCCTGGGGAGCTGG + Intronic
1044430711 8:92103328-92103350 CCGGGCGTCCGCCGGGGAGCAGG + Intergenic
1046118086 8:109808747-109808769 CTGTGCTTCCTGTAGGCAGCTGG - Intergenic
1048173423 8:132129871-132129893 CTCTGCTTCAGCTGGCGAGGAGG + Exonic
1049007234 8:139863336-139863358 CTGTGCTGCAGCTGGGCAGCGGG - Intronic
1049370845 8:142265484-142265506 CTGTGCCTCTGCAGGTGAGCAGG - Intronic
1049434584 8:142580482-142580504 CTGCGCTTGCGCCTGGGAGCTGG - Intergenic
1049537263 8:143188175-143188197 CTGGGCTTCTGCTGGGCACCAGG + Intergenic
1049575753 8:143388899-143388921 CTGTGCTGCGGGTGGGGAGGAGG + Intergenic
1049790955 8:144472516-144472538 CCGTGCTTCCACTTGGGGGCGGG + Intronic
1053749511 9:41237333-41237355 CTGGGCTTCGGCTGGGGCACGGG + Intergenic
1054254957 9:62802213-62802235 CTGGGCTTCGGCTGGGGCACGGG + Intergenic
1054336352 9:63813392-63813414 CTGGGCTTCTGCTGGGGCGCGGG - Intergenic
1055472552 9:76627583-76627605 CTGGGCTTCCGGTGGTCAGCTGG - Intronic
1057268026 9:93631668-93631690 CTGAGCTTCCAGTGGGGACCTGG + Intronic
1057305586 9:93910342-93910364 CTGTGATGCAGGTGGGGAGCTGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057565177 9:96160681-96160703 CTGTGCAGACGCTGGGGGGCTGG + Intergenic
1060201751 9:121655446-121655468 CTGGGCTTCAGCTTGGGTGCAGG + Intronic
1060845917 9:126837504-126837526 CTGTGCTTTCCCTGGGGAAGGGG + Exonic
1061809064 9:133151971-133151993 CTGTGGTTTGGCTGGCGAGCAGG - Intergenic
1062431511 9:136528701-136528723 CTGTGGCTCTGCTGGGGAGCAGG - Intronic
1203376280 Un_KI270442v1:380796-380818 CTGGGCTTCCGCTGGGGCGCGGG - Intergenic
1189320698 X:40085511-40085533 TTGGGTTTCCGATGGGGAGCTGG - Intronic
1190457416 X:50639714-50639736 CTATGCTTCTGCTGGGGTGAGGG - Intronic
1193654912 X:84187661-84187683 CTGCCCTTTCGCTGGGGAGCGGG - Intronic
1194076533 X:89400699-89400721 CTGGGCTTGAGCTGGGGACCTGG + Intergenic
1196191792 X:112802521-112802543 CTGAGATTCCGCTGGGTAGAGGG + Intronic
1200063380 X:153493707-153493729 CTGGGCTGCCGCTGGTGAACAGG + Intronic
1200152544 X:153958363-153958385 CTGTTCTTGGGCTTGGGAGCAGG - Intronic
1200429173 Y:3056219-3056241 CTGGGCTTGAGCTGGGGACCTGG + Intergenic