ID: 1143465543

View in Genome Browser
Species Human (GRCh38)
Location 17:7133991-7134013
Sequence GTTTCCCCCGGCCCGGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143465537_1143465543 4 Left 1143465537 17:7133964-7133986 CCAGAAGGGGGATGGAGTGGGAA 0: 46
1: 118
2: 93
3: 95
4: 307
Right 1143465543 17:7133991-7134013 GTTTCCCCCGGCCCGGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143465543 Original CRISPR GTTTCCCCCGGCCCGGAGTC GGG Intergenic
No off target data available for this crispr