ID: 1143465601

View in Genome Browser
Species Human (GRCh38)
Location 17:7134255-7134277
Sequence CTGTCCTTGCCGAGGTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143465595_1143465601 26 Left 1143465595 17:7134206-7134228 CCAGGATGGTCTTGGGAAATGCA 0: 13
1: 210
2: 227
3: 268
4: 410
Right 1143465601 17:7134255-7134277 CTGTCCTTGCCGAGGTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143465601 Original CRISPR CTGTCCTTGCCGAGGTCCGT GGG Intergenic
No off target data available for this crispr