ID: 1143471513

View in Genome Browser
Species Human (GRCh38)
Location 17:7178621-7178643
Sequence GGGCTCACCAGGACTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143471501_1143471513 16 Left 1143471501 17:7178582-7178604 CCTGGGACTGAGTCAAGACTGAG 0: 1
1: 0
2: 1
3: 22
4: 233
Right 1143471513 17:7178621-7178643 GGGCTCACCAGGACTAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143471513 Original CRISPR GGGCTCACCAGGACTAGAGT GGG Intronic
900431827 1:2606355-2606377 TGTCTCCCCAGGACTCGAGTGGG - Exonic
907597883 1:55736337-55736359 GGGCTCAGCCAGACTTGAGTTGG + Intergenic
907938631 1:59065746-59065768 GGGCTCACCAGCCCTGGATTAGG + Intergenic
912552938 1:110496160-110496182 GGGCGCTCCAGGACAAGAGCTGG - Intergenic
915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG + Intergenic
1064582435 10:16808102-16808124 GGGCTCACCAGGGCCAGGCTTGG - Intronic
1065796866 10:29315905-29315927 GGGCTGAGCAGGGCTGGAGTGGG - Intronic
1066543058 10:36469942-36469964 CTGGTCACCAGGACTACAGTGGG + Intergenic
1067939143 10:50638051-50638073 GTGGTCACCAGGAGTAAAGTGGG - Intergenic
1070557223 10:77537878-77537900 GGGCTCAGCAGGAATGGAATGGG + Intronic
1070597991 10:77846264-77846286 GGGCTCACCATGACTATACTGGG + Intronic
1075075838 10:119349607-119349629 TGGCTCACCAGGCCTCGAGATGG + Intronic
1076841520 10:133048251-133048273 GAGCTCACCAGGGCCAGAGCGGG + Intergenic
1077437452 11:2549708-2549730 GGGCTCCCCAGGCCTGGTGTGGG + Intronic
1078350597 11:10590011-10590033 TGGCTCTGCAGGCCTAGAGTTGG + Intronic
1079153998 11:17927054-17927076 GGGCATACCGGGAATAGAGTAGG - Intronic
1079324545 11:19480385-19480407 TGGCTGACCAGGACTGGATTTGG + Intronic
1081859440 11:46324231-46324253 TGGCTCACAAGGTCAAGAGTTGG - Intergenic
1086893384 11:92284528-92284550 GGACTCAGCAGGATTAGGGTGGG + Intergenic
1088841040 11:113627688-113627710 GGGCAAACCAGGCCTAGATTGGG - Intergenic
1094641907 12:32283964-32283986 GGGCTCACTTGGGCTAAAGTGGG + Intronic
1101574861 12:105987958-105987980 CTGCTGACCAGGCCTAGAGTAGG + Intergenic
1101796437 12:107979031-107979053 GGGCCTACCAGGACAAGATTTGG + Intergenic
1103848259 12:123914644-123914666 GGCATCACCAGGACCACAGTTGG + Intronic
1108172451 13:47755777-47755799 TGGGTCACCAGAACTAGAGTGGG + Intergenic
1110217335 13:73037363-73037385 GGACACACCAGGACAGGAGTAGG - Intergenic
1112311037 13:98317769-98317791 GCCCTCACCAGGACTGGAATTGG - Intronic
1116865535 14:50028717-50028739 GGGGTCACAAGGTCCAGAGTGGG - Intergenic
1121027713 14:90628669-90628691 CGGCTCTCCAGGACCAGAGGTGG + Intronic
1121234059 14:92379596-92379618 GGGCTCACCAGTCCTTGAATGGG - Intronic
1121485330 14:94310309-94310331 TGGCTCCCCATGCCTAGAGTGGG + Intronic
1122307574 14:100775673-100775695 GGGCACAGCAGGAGAAGAGTGGG - Intergenic
1126030617 15:44494347-44494369 TGGCTCACCAGCACTTGAGGAGG + Intronic
1131523472 15:93134450-93134472 AGTGTCACCAGGACTGGAGTTGG + Intergenic
1132945839 16:2531128-2531150 GGGCTCACCAGCTCTGGACTGGG - Exonic
1133866703 16:9650870-9650892 TGGATCACAAGGCCTAGAGTTGG + Intergenic
1137579338 16:49623744-49623766 GGGCTCACCTGGCGGAGAGTGGG - Intronic
1142041524 16:87897415-87897437 GGGGTCACCAGGACCACACTGGG + Intronic
1142746501 17:1961588-1961610 GAGCACACTAGGACAAGAGTGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143471513 17:7178621-7178643 GGGCTCACCAGGACTAGAGTGGG + Intronic
1145157596 17:20553443-20553465 GGGCTTCCCTGGACTAGGGTGGG + Intergenic
1145276969 17:21437342-21437364 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1145314799 17:21723235-21723257 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1145713241 17:26995172-26995194 GGCCTCACCAGGAGTGGACTTGG - Intergenic
1148586576 17:48785526-48785548 AGGCTCACCTGGATTAGAGCAGG - Intronic
1151355380 17:73555073-73555095 GGGTTCACCAGGGCTGGAGATGG - Intronic
1152108894 17:78346154-78346176 CAGCTCACCAGGAGTAGAGCTGG - Intergenic
1160191863 18:76721474-76721496 TGGCCCACCAGGACTAAGGTGGG - Intergenic
1161428939 19:4219694-4219716 GGGCTCGCCAGGCCCAGAGCCGG + Exonic
1165845043 19:38812754-38812776 GGGCCCCCCAGGATCAGAGTGGG + Intronic
1167074705 19:47241118-47241140 GGGCTCACCAAGTCTGGAGCTGG - Intergenic
1167925498 19:52818184-52818206 GGCTTCTCCAGGAGTAGAGTGGG - Intronic
1168510033 19:56966811-56966833 GGGCTCAGCAGGGCAAGGGTGGG + Intergenic
929705832 2:44210912-44210934 CGGCTCACGAGGTCAAGAGTTGG + Intronic
930340843 2:50112470-50112492 GGACTCATCAAGACTAAAGTCGG - Intronic
931944336 2:67288247-67288269 GGGCTCACCTGGGATAGAGCAGG + Intergenic
942043399 2:172085366-172085388 GGGCTCCGCTGGACTAGAGCGGG - Exonic
946033440 2:216723360-216723382 GGGATCACCAGTCCTAGACTAGG - Intergenic
947496748 2:230643269-230643291 GGTCTCTGCAGGACTAGAGTGGG - Intergenic
1170433446 20:16298130-16298152 TGATTCACCAGGACTAGGGTGGG - Intronic
1171339292 20:24414562-24414584 GGGCTCACCAGCATTGGATTTGG - Intergenic
1174498476 20:50966511-50966533 GGCCACACTAGGACTAGAATGGG + Intergenic
1174677645 20:52373920-52373942 GGGCTCACCTGGGAGAGAGTCGG - Intergenic
1174839765 20:53890862-53890884 GGGCTCACCAAGGCCAGAATGGG - Intergenic
1176196154 20:63837054-63837076 TGGCTCACCAGGCCTAGGGGAGG + Intergenic
1176243449 20:64085406-64085428 GGTGTCCCCAGGACTAGAGCTGG + Intronic
1178798825 21:35772721-35772743 TGGCTCTCCAAGACTAGAGAGGG + Intronic
1180746155 22:18090450-18090472 GGGCTCACCAGGCCAAGAGCAGG - Exonic
1182850079 22:33466188-33466210 GCGCTGACCATGACAAGAGTTGG - Intronic
1183086190 22:35488728-35488750 GGGCTCACCAGGTGCAGAGTGGG + Intergenic
1183750860 22:39719559-39719581 GGGCTCACAAGGCCCAGATTTGG - Intergenic
950148366 3:10667625-10667647 GGGCTCAGCAGGACAAGTGAAGG + Intronic
955823123 3:62917559-62917581 GGCCACATAAGGACTAGAGTTGG + Intergenic
960335812 3:116416362-116416384 GGGAGCACCATGATTAGAGTTGG + Intronic
961443934 3:126969407-126969429 GGGCTCACCAGGCCAAGATGAGG + Intergenic
969895760 4:10302992-10303014 GGGCTCGCCATGACTGGAGCTGG - Intergenic
975303458 4:72819583-72819605 AAGCTCTCCAGAACTAGAGTTGG - Intergenic
975781037 4:77840034-77840056 GATCTCACCAAGACTAGAGAGGG + Intergenic
984955436 4:185040768-185040790 GGGCTTGCCAGGGCTAGGGTGGG + Intergenic
985290248 4:188379376-188379398 GGGCAGAGCAGGACTAGAGATGG - Intergenic
988032664 5:25784070-25784092 GGGCTCACAAGGTCAAGAGATGG - Intergenic
991111254 5:62902157-62902179 GGGCTACCCAGGCCTGGAGTAGG + Intergenic
992990020 5:82274534-82274556 GGGCGCACCAGGAAGGGAGTGGG - Exonic
994952512 5:106482411-106482433 GGTCTGACAAGGACTAGATTTGG - Intergenic
997522888 5:134534628-134534650 GGGCTCAGCAGGAATGGACTGGG + Intronic
999065969 5:148685963-148685985 GGGCTGCCCAGGACTAAAGCTGG + Intergenic
1001848799 5:174944763-174944785 GGTCTCACCAGGAATTGAGTTGG - Intergenic
1005026648 6:21468697-21468719 GGGCTGACCAGGCCAAGGGTGGG + Intergenic
1007777164 6:44230245-44230267 AGGCTCACCAAGAGTAAAGTAGG + Intronic
1008518929 6:52344591-52344613 GGGCTTGCCAGGAGTAGAGAAGG - Intergenic
1018067499 6:160134111-160134133 GGCCTCACCAGTAGTAGAGCAGG - Exonic
1019625115 7:2011985-2012007 GGGCCCAGCAGGGCTAGAGCAGG - Intronic
1023154392 7:37233442-37233464 CAGCTCACCAGAACGAGAGTTGG - Intronic
1030278462 7:107744398-107744420 GAGCTCAGCAGAACCAGAGTAGG - Intronic
1034476022 7:151282466-151282488 GGGACCATCAGGAATAGAGTGGG - Intergenic
1034901165 7:154908861-154908883 GGGGTCTCCAGGACTGGAGGAGG - Intergenic
1035101724 7:156402840-156402862 TGGCTCAGGAGGACTAGAATTGG - Intergenic
1035164851 7:156980976-156980998 GGGAGCAACAGGAGTAGAGTGGG - Intergenic
1035927532 8:3744362-3744384 GGGCACAGCAGGACCAGATTTGG + Intronic
1036621592 8:10427722-10427744 GGGCTCAGCAGGGCCACAGTGGG - Intronic
1052295409 9:26892251-26892273 GGGCTCACCAGGACTTAGGTAGG + Intronic
1055026024 9:71722459-71722481 TGGGTCAGCAGCACTAGAGTTGG + Exonic
1056828073 9:89890648-89890670 GGGCTCCCCAGCACTGGAGCGGG - Intergenic
1058647187 9:107141589-107141611 GGGCTCACCAGGTCTGGAAATGG + Intergenic
1059472522 9:114516909-114516931 GGAGCCACCAGGTCTAGAGTTGG - Intergenic
1189351929 X:40281958-40281980 GGATTCAGCAGGTCTAGAGTGGG - Intergenic
1199601717 X:149545096-149545118 GGGCTCAGCAGCCCTGGAGTAGG + Intronic
1199648658 X:149934387-149934409 GGGCTCAGCAGCCCTGGAGTAGG - Intronic
1199654445 X:149980788-149980810 TGGTTCAGCAGGCCTAGAGTGGG - Intergenic
1201143491 Y:11047784-11047806 GGTCTCACCAGGACAGGAGTGGG + Intergenic