ID: 1143473104

View in Genome Browser
Species Human (GRCh38)
Location 17:7188444-7188466
Sequence TGATTCTCAGGTGCTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143473104_1143473108 2 Left 1143473104 17:7188444-7188466 CCCACTGGAGCACCTGAGAATCA No data
Right 1143473108 17:7188469-7188491 GAAAGGAATAGTACCCCAGCAGG No data
1143473104_1143473109 14 Left 1143473104 17:7188444-7188466 CCCACTGGAGCACCTGAGAATCA No data
Right 1143473109 17:7188481-7188503 ACCCCAGCAGGTGCCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143473104 Original CRISPR TGATTCTCAGGTGCTCCAGT GGG (reversed) Intergenic
No off target data available for this crispr