ID: 1143476968

View in Genome Browser
Species Human (GRCh38)
Location 17:7208413-7208435
Sequence CTGGCGGGAGAGGGGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1001
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 911}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143476968_1143476979 6 Left 1143476968 17:7208413-7208435 CCAACAGCCCCCTCTCCCGCCAG 0: 1
1: 0
2: 6
3: 83
4: 911
Right 1143476979 17:7208442-7208464 AGCACCTCTCATCAATCCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143476968 Original CRISPR CTGGCGGGAGAGGGGGCTGT TGG (reversed) Intronic
900119748 1:1043462-1043484 GTGGCGGGTGAGGGGTCTGGTGG + Intronic
900322730 1:2093150-2093172 CTGGCGGGAGAGGAGGCAGATGG + Intronic
900407337 1:2498429-2498451 GGGGCTGGGGAGGGGGCTGTTGG + Intronic
900578927 1:3398400-3398422 CTGGTGGGGGAGGCGGCTATTGG - Intronic
900621947 1:3591605-3591627 GGCGCGGGCGAGGGGGCTGTTGG + Intronic
900640124 1:3684520-3684542 CTGGAGGGAGTGGGGGCTGTGGG + Intronic
900973584 1:6004836-6004858 CTGGAGGGAGACGGGGCTGGAGG - Intronic
900980696 1:6044568-6044590 CTGGCTGTAGAGGTGGATGTTGG + Intronic
901063881 1:6485763-6485785 CTGGGCGGAGGCGGGGCTGTGGG - Intronic
901266479 1:7914327-7914349 GTGGCGGGTGGGGGGGATGTGGG - Intergenic
901478228 1:9505428-9505450 CTGGCCGCAGAGGTGGCTGGTGG - Intergenic
902220507 1:14961487-14961509 CTCCCGGGAGAGAGGGATGTGGG - Intronic
902372000 1:16013164-16013186 CTGTCTGGGGAGGGGGCTGCTGG + Intergenic
902744768 1:18466441-18466463 GTGGCTGGAGCAGGGGCTGTCGG - Intergenic
902790001 1:18761412-18761434 CTGGTGGGAGCGGGAGCTGGAGG - Intergenic
902932235 1:19739827-19739849 CTGCCGGGAGAGCAGGATGTGGG + Exonic
904077117 1:27851765-27851787 ATGACGGGAGACGGGGCTTTAGG + Intergenic
904292958 1:29499382-29499404 CTGGCTGGAGAAGGGGCTCATGG + Intergenic
904342206 1:29843905-29843927 CTGGCTGGAGTGTGAGCTGTGGG + Intergenic
904378822 1:30097590-30097612 CTGGGGTGAGCAGGGGCTGTAGG + Intergenic
904465582 1:30705364-30705386 CAGGCGGGAGTGGAGGCTGCCGG + Intergenic
905658418 1:39701347-39701369 ATGGCGGGGGAGGGGGCAGCGGG + Intronic
906078585 1:43069163-43069185 GTGGCTGGAGAGGGGACTGGAGG + Intergenic
906284419 1:44577342-44577364 CTGGGAGGAGAGGTGGCAGTGGG - Intronic
906284429 1:44577378-44577400 CTGGGAGGAGAGGTGGCAGTGGG - Intronic
906532562 1:46532121-46532143 CGGGAGGGAGGGGTGGCTGTGGG - Intergenic
906586829 1:46985410-46985432 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
906753183 1:48285024-48285046 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
906843035 1:49160645-49160667 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
907015234 1:51005768-51005790 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
907733837 1:57092663-57092685 CTGGCGGGGGAGGGGGGTGGGGG + Intronic
907949100 1:59163811-59163833 CTGTAGGGAGAGGCAGCTGTGGG - Intergenic
908592923 1:65652527-65652549 CTTGGGGAAGAGGTGGCTGTGGG + Intergenic
908601360 1:65743792-65743814 CTCGGGGAAGAGGTGGCTGTGGG - Intergenic
908690667 1:66775856-66775878 GTAGCGGGAGAAGGGGCAGTAGG + Intronic
909397884 1:75191365-75191387 CTGGAGAGAGTGGGGGCTGCGGG - Intergenic
910331047 1:86072529-86072551 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
911632709 1:100200451-100200473 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
911941918 1:104057615-104057637 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
912094422 1:106121014-106121036 TTGGCCAGAGAGGGGGCTGAGGG + Intergenic
912433072 1:109639924-109639946 CTGGGTGGAGTGGGGGCTGCTGG - Intergenic
912654362 1:111472368-111472390 ATGGAGGGAGAAAGGGCTGTGGG - Intergenic
913021392 1:114791936-114791958 CTGGGGGAAGGGGAGGCTGTGGG - Intergenic
915061318 1:153188300-153188322 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
915362245 1:155293161-155293183 CTGGCCGGTGAGGGGGATATTGG - Exonic
915688502 1:157662193-157662215 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
916047190 1:161008924-161008946 CTGGTGGGAGAGAGGGAGGTGGG - Intronic
916406330 1:164501023-164501045 CTGGAGGAACAGGTGGCTGTGGG + Intergenic
916731549 1:167571511-167571533 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
916973496 1:170049364-170049386 CTGGCAGGAGGGGTGGCTGTGGG + Intronic
917157999 1:172025347-172025369 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
917274682 1:173319385-173319407 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
917401319 1:174652892-174652914 CTGGGGGAAGGGGAGGCTGTGGG - Intronic
917406015 1:174709219-174709241 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
917530590 1:175831483-175831505 CTGCCGGGAGAGTGGGCTGAGGG + Intergenic
917768529 1:178250171-178250193 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
917844449 1:179008847-179008869 CTGGCCAGAGAGGGGAGTGTTGG - Intergenic
917915267 1:179694895-179694917 CTGGAGGAAGGGGGAGCTGTGGG + Intergenic
918167187 1:181961521-181961543 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
918906747 1:190505976-190505998 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
920458359 1:206117528-206117550 CTGGAGGGAGGGGGGGCAGAGGG + Intronic
921296797 1:213712109-213712131 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
922073364 1:222218046-222218068 CTGGTGGGAAAGGGAGCTATTGG - Intergenic
922253376 1:223870763-223870785 CTGGGGGGAGGGGCTGCTGTGGG - Intergenic
922314806 1:224433903-224433925 CTGGCGGCGGAGGGGGCGGAAGG + Exonic
922937325 1:229432519-229432541 GGGGCGGGAGAGGGGACTGGGGG + Intronic
924775726 1:247113436-247113458 CTGGCAGGAGCAGGTGCTGTGGG + Intergenic
1062790481 10:301207-301229 CTGTCAGGAGAGAGGGCCGTGGG + Intronic
1062805374 10:415960-415982 CGCGCTGGGGAGGGGGCTGTGGG - Intronic
1062913653 10:1231025-1231047 CTGGCTGGAGAGGCTGCAGTTGG + Intronic
1062992919 10:1836808-1836830 CAGGTGGGAGAGGGGGCGGCAGG - Intergenic
1063150584 10:3332907-3332929 GAGGCAGTAGAGGGGGCTGTGGG + Intergenic
1063629259 10:7719058-7719080 CTGCCGGGGGAGGGGCATGTTGG - Intronic
1064757900 10:18588310-18588332 CTGGGGGGAGGGGTGGCTGTGGG + Intronic
1065787402 10:29229500-29229522 CCGCCTGGAGAGGAGGCTGTGGG + Intergenic
1065907700 10:30272642-30272664 CTGGGGGAAGGGGAGGCTGTAGG + Intergenic
1066159715 10:32714943-32714965 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1066376483 10:34861901-34861923 CTGGAGAGAGAGAGGGCGGTAGG - Intergenic
1066460536 10:35608551-35608573 CAGGCGGGTCAGGGGGCTGCAGG - Exonic
1066466980 10:35660518-35660540 ATGTCGGGAGAGTGGGCTGGTGG + Intergenic
1066993437 10:42539308-42539330 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1066996253 10:42566798-42566820 CTGGATGTAGAGGAGGCTGTTGG - Intergenic
1067071729 10:43137805-43137827 CTGGCGGGGGAGGGGACGCTGGG - Intergenic
1067209640 10:44249511-44249533 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1067236327 10:44453797-44453819 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1067579509 10:47433415-47433437 CTGGGGAAAGAGGTGGCTGTGGG - Intergenic
1067759101 10:49029904-49029926 CTGGTGGGAGAGGGTGATGGAGG + Intronic
1068086045 10:52374823-52374845 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1069120780 10:64567068-64567090 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1069348928 10:67502564-67502586 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1069692634 10:70363946-70363968 CAGGGAGGAGAGGGGGCTGGAGG - Intronic
1070288466 10:75100040-75100062 CAGGCAGGAGATGGGGCTTTGGG + Intronic
1070751223 10:78965198-78965220 CTGGCAGGGGAGGGGGCTGCGGG - Intergenic
1070877192 10:79825789-79825811 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1071341244 10:84651244-84651266 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1071427582 10:85574689-85574711 CAGGCTGGAGATGGTGCTGTTGG - Intergenic
1071643688 10:87341833-87341855 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1072044945 10:91644708-91644730 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1072365306 10:94703330-94703352 CTGGAGGAAGGGGTGGCTGTGGG - Intronic
1072619065 10:97067895-97067917 GCGGCGGGGCAGGGGGCTGTGGG - Intronic
1072840032 10:98762283-98762305 CTGGCGGGGGTGGGGGGTGGGGG + Intronic
1072923914 10:99599692-99599714 CTGGCTGGACAGGTGACTGTGGG - Intergenic
1072938089 10:99732419-99732441 GTGGCGGGGGAGGGGACGGTCGG + Intronic
1072953527 10:99869585-99869607 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1072954075 10:99873613-99873635 TTGGGTGGAGAGGGTGCTGTGGG + Intergenic
1073139575 10:101238429-101238451 CTAACGGGAGAAGGGGCTGGGGG + Intergenic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1073884238 10:108019736-108019758 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1074085795 10:110208274-110208296 CGAGGGGGAGAGGGGCCTGTCGG + Intronic
1074668451 10:115758723-115758745 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1075401063 10:122162065-122162087 CTTGCGGGGAAGGTGGCTGTCGG - Intronic
1075514062 10:123095266-123095288 CTGCTGGCAGAGGGGGGTGTGGG - Intergenic
1075728680 10:124623524-124623546 GTGGCGGGCGAAGGGGCTCTGGG + Exonic
1075735205 10:124660508-124660530 CATGCTGGCGAGGGGGCTGTGGG - Intronic
1075983862 10:126766640-126766662 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1076012906 10:127004751-127004773 GTGGCGGGGCAGGGGGCCGTTGG - Intronic
1076149283 10:128149883-128149905 CGGGCGGGAACGCGGGCTGTGGG - Intergenic
1076514666 10:131037228-131037250 CTGGAGGGAGAGACGGCTGCTGG - Intergenic
1076699593 10:132264575-132264597 CTGGTGGGAGAGGGTCCTGGAGG - Intronic
1076839856 10:133040618-133040640 GTGGCAGGGGGGGGGGCTGTGGG + Intergenic
1076871593 10:133197494-133197516 CTGCCTGGAGAGGGAGCCGTTGG - Intronic
1076997761 11:307279-307301 CTGACAGAAGAGGGGGCTGTGGG - Intergenic
1077050289 11:563389-563411 CTGGAGGCAGAGGGCCCTGTGGG - Exonic
1077101255 11:823599-823621 CGGGCGGGAGAGGGCGGGGTGGG + Intronic
1077469628 11:2751083-2751105 CTGTGGGGTGCGGGGGCTGTGGG - Intronic
1077470918 11:2760115-2760137 CTGGCTGGGGTGGGGGCTGCTGG - Intronic
1077633786 11:3828095-3828117 GTGGTGGGTGATGGGGCTGTGGG - Exonic
1077713707 11:4559938-4559960 CTGGAGGGAGGGGCGGCTGTGGG + Intergenic
1078099176 11:8319615-8319637 CTGGCAGGAGAGGAGGCAATGGG - Intergenic
1078256596 11:9664051-9664073 CTGGCGGGGGCGGGGCCTGGCGG + Intergenic
1078331438 11:10425683-10425705 CTGGGGGAAGCGGCGGCTGTGGG - Intronic
1078686144 11:13534264-13534286 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1078730160 11:13966196-13966218 TTGGAGGGAGGGGGGACTGTGGG - Intronic
1078986742 11:16605320-16605342 CTGGCGGGAGCGGGGGCGAGGGG - Intronic
1079060268 11:17242294-17242316 CTGGAGGGAGAGGTTGCAGTGGG + Intronic
1079316583 11:19412467-19412489 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1079696175 11:23484566-23484588 CAGGGGGAAGAGGTGGCTGTGGG + Intergenic
1080334591 11:31181260-31181282 CTGGGGGAAGGGGAGGCTGTGGG + Intronic
1080404367 11:31965780-31965802 CTGGCCAGAGCTGGGGCTGTGGG + Intronic
1081094910 11:38920931-38920953 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1081363342 11:42205894-42205916 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1081534536 11:43987425-43987447 GTGGCGGGGGACGGGGCTGCAGG + Intergenic
1081677321 11:44978111-44978133 ATGGCGGCAGAGGGGGCAGTGGG + Intergenic
1081914191 11:46720273-46720295 ATGGGAGGAGAGGGGGCAGTGGG - Intronic
1081979528 11:47257819-47257841 GTGGCGGGAGAGGGGGTGGCCGG + Intronic
1083227697 11:61295084-61295106 CGCGCGGGAGAGGGGGCTGCCGG + Exonic
1083471222 11:62885370-62885392 CTGGTGGGAAAGGGGGCAGATGG + Intronic
1083732780 11:64661834-64661856 CTGGCCGCAGAGTGGGCTCTTGG - Intronic
1084269205 11:68020097-68020119 CTGCCTGCAGAGAGGGCTGTGGG - Intronic
1084317142 11:68352087-68352109 CTGGAGCGAGAGTGAGCTGTGGG + Intronic
1084482994 11:69432795-69432817 CTGCCTGGAACGGGGGCTGTAGG + Intergenic
1084588066 11:70074734-70074756 CTGGAGGCAGAGGGTGCTGCTGG + Intergenic
1084612459 11:70212298-70212320 CGGGCAGGAGTGGGGGCTGCAGG - Intergenic
1084706279 11:70817658-70817680 CTGGCTGGACAAGGTGCTGTGGG + Intronic
1084891094 11:72237542-72237564 CTGGCTGGTGAGGGGCCTGGGGG - Exonic
1085402505 11:76243210-76243232 CTGGTGGGAGAGAGGGCTAAGGG + Intergenic
1085433913 11:76481792-76481814 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1085640094 11:78188209-78188231 CAGGTCGGAGTGGGGGCTGTAGG - Intronic
1086532313 11:87800779-87800801 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1087305815 11:96487684-96487706 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1087667840 11:101070867-101070889 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1087703735 11:101466302-101466324 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1087925201 11:103911129-103911151 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1088066507 11:105726437-105726459 CTGGGGGGAGGGGCAGCTGTGGG + Intronic
1088078260 11:105878510-105878532 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1088211882 11:107466050-107466072 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1088307291 11:108423454-108423476 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1089579156 11:119470767-119470789 CTGGAGGGAGAGGGGCCAGGCGG - Intergenic
1089765975 11:120766047-120766069 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1090024087 11:123152931-123152953 CTGGAGGGAGAGAAGGATGTTGG + Intronic
1090464881 11:126925097-126925119 CGGGGGGGGGGGGGGGCTGTTGG + Intronic
1090720460 11:129467596-129467618 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1090725053 11:129517700-129517722 CTGGAGGGAGGGGTGGCTGTGGG - Intergenic
1090896068 11:130976683-130976705 CTGGGGGAAAAGGCGGCTGTGGG - Intergenic
1090928431 11:131273345-131273367 CTGGCGGAAGGGGTGGCTCTGGG - Intergenic
1091417166 12:298090-298112 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1091556051 12:1574350-1574372 CTGGGGTGAGAGGAGGCTGGTGG + Intronic
1091571590 12:1691310-1691332 CGGGCGGGAGAGCGCGCTCTCGG + Intronic
1091712183 12:2749942-2749964 CTGGGGGGAGGAGTGGCTGTAGG - Intergenic
1092105973 12:5922049-5922071 GTGGCTGGAGAGGAGGATGTGGG - Intronic
1092440452 12:8496452-8496474 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1093055774 12:14554326-14554348 CTGCCGAGAGAGGGAGCTTTAGG - Intronic
1093333262 12:17868944-17868966 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1093694812 12:22147028-22147050 CTGGGGGAAGGGGAGGCTGTGGG + Intronic
1093714549 12:22366483-22366505 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094733057 12:33200449-33200471 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1095439715 12:42228234-42228256 CTGGAGGGAGGTGGGGGTGTCGG + Intronic
1095920585 12:47526180-47526202 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1096586211 12:52621809-52621831 CTGCTGGGGGAGGGGGCAGTTGG - Intergenic
1096982636 12:55737231-55737253 CTGCCAGGTGAGGGAGCTGTTGG - Intergenic
1097167434 12:57093304-57093326 CTGGCTGGAGGGGGGGCAGAAGG + Intronic
1097412173 12:59268445-59268467 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1097619562 12:61923140-61923162 CTGGGGGAAGAGGCGGCTGTAGG + Intronic
1097654377 12:62343011-62343033 CTGGGGGGAGGGACGGCTGTGGG - Intronic
1098151816 12:67555304-67555326 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1098438735 12:70496815-70496837 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1098704651 12:73671944-73671966 CTGTGGGGAGGGGCGGCTGTGGG + Intergenic
1099053414 12:77808770-77808792 CTGGTGGAAGCGGGGGCTATGGG - Intergenic
1099071312 12:78048813-78048835 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1099492095 12:83300293-83300315 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1099897597 12:88668001-88668023 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1100740095 12:97581928-97581950 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1100768683 12:97897902-97897924 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
1101487945 12:105184850-105184872 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1102222012 12:111201184-111201206 CAGGCAGGAGAGGGCGCTGATGG - Intronic
1103169105 12:118798738-118798760 CTGGGGGAAGAGGCGGCTGTGGG - Intergenic
1104602240 12:130162009-130162031 CTGGCGGGAGAAGGGGTTTGGGG - Intergenic
1104831582 12:131755976-131755998 AAGGCAGAAGAGGGGGCTGTAGG - Intronic
1105070414 12:133231165-133231187 CTGGCCAGAAAGGGGGCTATTGG - Intronic
1105520920 13:21130160-21130182 ATGGCGGGAGAGGAGGGTGGAGG + Intergenic
1105552427 13:21410454-21410476 CTGGGGGAAGAGGCAGCTGTAGG - Intronic
1105737331 13:23285204-23285226 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1106336539 13:28788799-28788821 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1106426537 13:29636253-29636275 CTGGGGGAAGAAGTGGCTGTGGG - Intergenic
1106874184 13:34054364-34054386 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1106983812 13:35321691-35321713 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1107641909 13:42452764-42452786 CTGGGGGAAGGGGCGGCTGTAGG - Intergenic
1107968793 13:45621975-45621997 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
1108262750 13:48675236-48675258 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1109293787 13:60505485-60505507 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1110662871 13:78078685-78078707 CTGTAGGGAGAGTGGACTGTTGG - Intergenic
1111950037 13:94702928-94702950 CTGGTTGGAGAAGGGGCTGGCGG - Intergenic
1112493235 13:99885399-99885421 CTGGCAGGAGATGAGGCTGAGGG + Intronic
1112570436 13:100588741-100588763 CTGCCGGCAGCCGGGGCTGTCGG + Intronic
1113892688 13:113744556-113744578 CTGGGGGGAGAAGGAGCAGTTGG - Intergenic
1114133507 14:19820524-19820546 CTGGGGGGAAGGGCGGCTGTGGG - Intronic
1114243535 14:20891588-20891610 GTGGCAGCAGAGGGGCCTGTGGG + Intronic
1114250471 14:20955673-20955695 GTGGCCGCAGAGGGGCCTGTGGG + Intronic
1114695430 14:24623312-24623334 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1115124243 14:29972866-29972888 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1115511328 14:34140185-34140207 CTGGGGGAAGGGGCGGCTGTTGG + Intronic
1115912103 14:38268549-38268571 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1116002466 14:39259191-39259213 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1116511835 14:45756193-45756215 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1116876375 14:50116257-50116279 CTGGCGGGCGGGCGGGATGTGGG - Intronic
1117104323 14:52382697-52382719 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1117121119 14:52568839-52568861 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1117172442 14:53114263-53114285 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1117299203 14:54407440-54407462 CTGGCGGAAGGGATGGCTGTGGG - Intronic
1117850018 14:59958239-59958261 CTGGTGGAAGGGGTGGCTGTGGG - Intronic
1118489923 14:66249036-66249058 CTGGAGGGTGAGGGGGAGGTGGG + Intergenic
1119018429 14:71084445-71084467 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1119174607 14:72559960-72559982 TTGGCTGGAGAGGGGACTGTGGG - Intronic
1119379279 14:74218371-74218393 GTGGGGGTGGAGGGGGCTGTTGG + Intergenic
1120201385 14:81541223-81541245 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1121144659 14:91573800-91573822 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121144677 14:91573873-91573895 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121144688 14:91573910-91573932 CTGGCAGGAGAGGAGGAGGTTGG + Intergenic
1121473283 14:94173737-94173759 CTGACGGGGGAGGGGGCTGTGGG - Intronic
1121530793 14:94651722-94651744 CTGGGGGGTGGGGGGGTTGTTGG + Intergenic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122811902 14:104293362-104293384 CTGGAGGGCCAGGGGGCTGCAGG + Intergenic
1122930902 14:104932705-104932727 CGGGCTGCAGAGGGGCCTGTGGG + Intronic
1122999087 14:105282478-105282500 CGGGCGGGAGTGGAGGCCGTGGG + Intronic
1123012897 14:105357817-105357839 CTGTCGTGAGAGTGGGGTGTCGG + Intronic
1123449560 15:20351336-20351358 CTGGAGGGACAGGGGGCCTTTGG + Intergenic
1123576579 15:21676093-21676115 CTGGGGGGAAGGGCGGCTGTGGG - Intergenic
1123613201 15:22118561-22118583 CTGGGGGGAAGGGCGGCTGTGGG - Intergenic
1123676423 15:22714562-22714584 CGGGCGGGAGAGAGGGCTGCCGG + Intergenic
1124328638 15:28788823-28788845 CGGGCGGGAGAGAGGGCTGCCGG + Intergenic
1124666763 15:31599051-31599073 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1124894001 15:33758688-33758710 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1125288569 15:38120268-38120290 CTGGGGGAAGGGGGAGCTGTGGG + Intergenic
1125329953 15:38573162-38573184 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1125521023 15:40347891-40347913 CTGGGGGAAGAGGGGGCTGCGGG + Intergenic
1125821727 15:42637562-42637584 CTGGAGGTATAGGGGGCTGGGGG + Intronic
1125954028 15:43777029-43777051 CTGGCGGGAGGTGGGGCCGGGGG - Exonic
1126568635 15:50126852-50126874 CGGGGGGGTGTGGGGGCTGTGGG - Intronic
1127390406 15:58500736-58500758 GTGGGGGGAGAGGGGGGTGGTGG - Intronic
1127452533 15:59131132-59131154 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1127546704 15:59999683-59999705 CTGGCGGGGGTAGGGGGTGTGGG + Intergenic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1128153623 15:65378102-65378124 CTCCGGGGAGAGGGGGCTGGGGG - Intergenic
1128639121 15:69322990-69323012 CTGGTGGGAGGTGGGGCTGGGGG + Intronic
1129126821 15:73448543-73448565 CTGGAGGAAGGGGTGGCTGTGGG + Intronic
1129271543 15:74421745-74421767 TTGGCAGGAGCGGGGGCTGGGGG + Intronic
1129499097 15:76018923-76018945 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1129524080 15:76203163-76203185 CTGGCAGGGGTGGGGGCTGCGGG - Intronic
1129563260 15:76593366-76593388 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1130062747 15:80581321-80581343 TGGGCTGGAGAGGGGGCTGTAGG - Exonic
1130724079 15:86420009-86420031 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1130908935 15:88257739-88257761 CTGCCGGGTGAGGGGGCGGGCGG + Intergenic
1131230883 15:90658462-90658484 CTGGCTGGAGAGGCTGATGTGGG + Intergenic
1131231229 15:90660984-90661006 CTGGCTGGAGAGGCTGATGTGGG - Intergenic
1131393575 15:92069105-92069127 CTGGGGGGAGTGGGGGGTGGCGG - Intronic
1132319470 15:100914986-100915008 CTGCCTGGGGAGGGAGCTGTTGG + Exonic
1132374331 15:101318811-101318833 ATGGCGTGTGACGGGGCTGTCGG + Intronic
1132411620 15:101582815-101582837 GTGGCGGGGGTGGGGGCTGGAGG - Intergenic
1202985447 15_KI270727v1_random:410338-410360 CTGGGGGGAAGGGCGGCTGTGGG - Intergenic
1132685599 16:1160777-1160799 TTGCCGGGAGCGGGAGCTGTGGG + Intronic
1132726023 16:1338710-1338732 CTGGCGGGAAATGGCCCTGTGGG - Intronic
1132757701 16:1493955-1493977 CTGGCGCGAGAGGGAGGTGGAGG - Intronic
1132831395 16:1930027-1930049 CTGGTGGGGGTGGGGGCCGTGGG - Intergenic
1132882997 16:2170587-2170609 GTGGAGGGAGAGGCGCCTGTCGG - Intronic
1133402376 16:5498064-5498086 CTTGAGGGAGAGGGGGCAGAGGG + Intergenic
1133777716 16:8910573-8910595 GGGGAGGGAGAGGGGGATGTTGG - Intronic
1134027571 16:10966010-10966032 CTGGCAGGATAAGGAGCTGTTGG - Intronic
1134091453 16:11393646-11393668 CTGGCTGGGGAGGCTGCTGTTGG + Intronic
1134249428 16:12563990-12564012 CTGGGGGAAGAGGGTGCTGCAGG - Intronic
1136072411 16:27795825-27795847 GAGGCGGGAGATGGGGCTGGAGG - Intronic
1136417946 16:30114677-30114699 CTGGCGGGAGAGGGGCAGGCAGG + Exonic
1136451045 16:30354518-30354540 CTGGCGGGAGAGGGGCGGGGCGG - Intronic
1136478354 16:30526710-30526732 CGGGCGGGAGCGGGGGCCGGGGG - Intronic
1136690545 16:32025201-32025223 TTGGCGGGGGAGGGGACTGGGGG - Intergenic
1136784287 16:32925525-32925547 CCGGCGGCGGCGGGGGCTGTGGG + Intergenic
1136885497 16:33928281-33928303 CCGGCGGCGGCGGGGGCTGTGGG - Intergenic
1138151602 16:54662206-54662228 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1138179392 16:54931663-54931685 CTGGCGGGAAGGGGTTCTGTGGG + Intronic
1138183999 16:54962703-54962725 TTGGCTGGAGAGGTGGCGGTGGG + Intergenic
1138433368 16:56983473-56983495 CTGGGGTGACTGGGGGCTGTTGG + Intronic
1138519657 16:57563720-57563742 CTGGGGGGAGAAGGTTCTGTGGG + Intronic
1139383374 16:66548598-66548620 CTGGGGGGAGAGGGTGGTGGTGG + Intronic
1140219518 16:73033508-73033530 CTGGGGGGAAAGGGGGCAGGCGG + Intronic
1140453783 16:75092752-75092774 AAGGAGGCAGAGGGGGCTGTGGG + Intronic
1141166711 16:81665722-81665744 CTGACTGGGGAAGGGGCTGTAGG - Intronic
1141449070 16:84085045-84085067 CTGGCGTGAAAGGGGGGTGCCGG - Exonic
1141753424 16:85975203-85975225 GAGTGGGGAGAGGGGGCTGTGGG - Intergenic
1142133701 16:88442304-88442326 CTGGCGGGTGGGGAGGCGGTGGG - Intergenic
1142156283 16:88534143-88534165 GCGGCGGGAGAGGGGGCCGGGGG - Exonic
1203086944 16_KI270728v1_random:1189531-1189553 CCGGCGGCGGCGGGGGCTGTGGG + Intergenic
1142982914 17:3681695-3681717 GTGGGAGGAGAGGGCGCTGTGGG - Intronic
1143190185 17:5034807-5034829 CTGGAGGGAGAGGTGGCCGGGGG + Intronic
1143376681 17:6471318-6471340 CTCCAGGAAGAGGGGGCTGTGGG + Exonic
1143476968 17:7208413-7208435 CTGGCGGGAGAGGGGGCTGTTGG - Intronic
1143499229 17:7329277-7329299 CGGGTGGGAGTGGGGGCTCTGGG - Exonic
1143920734 17:10329258-10329280 TTGGAGGGAGAGGGGAGTGTGGG - Intronic
1144371821 17:14598312-14598334 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1144684673 17:17218166-17218188 ATGCCGGGAGAGAGGGGTGTGGG - Intronic
1145312378 17:21707706-21707728 CTGGGTGGAGAGTGGGCTGAAGG - Intergenic
1146000292 17:29126635-29126657 CTGGAAGGAGAGGGGTCTGGAGG - Intronic
1146766229 17:35524269-35524291 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1146825887 17:36023131-36023153 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1147805311 17:43126834-43126856 GTGGAGGGAGAGGCGGGTGTGGG + Intergenic
1148403198 17:47386240-47386262 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148550078 17:48544920-48544942 ATGGTGGGGGAGGGGGCTGCTGG + Exonic
1148868417 17:50641290-50641312 ATGGTGGGGGAGGGGGCTGTGGG + Intronic
1148967441 17:51447533-51447555 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1149467499 17:56891551-56891573 CTGGCGGGAGGGTGGGAGGTGGG - Exonic
1149865933 17:60150923-60150945 CTGGCGGGGGCGGGGGGTGGGGG + Intronic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1149909173 17:60552088-60552110 CTGGAGGGAGGTGGGGGTGTCGG + Intergenic
1150090817 17:62323136-62323158 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1150545829 17:66155928-66155950 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1150652692 17:67020116-67020138 CTGGCAGGAGCTGCGGCTGTTGG + Intronic
1151164632 17:72193170-72193192 CTGGCTGGAGAAGAGGCTGGAGG - Intergenic
1151314382 17:73312442-73312464 CTGTCGGGAGATGGGGCAGGAGG + Intergenic
1151657784 17:75503779-75503801 CAGGCGGGGGAGGGGCCTGATGG - Intronic
1151728060 17:75895834-75895856 GTGGAGGGCGAGGGGGCTATGGG - Intronic
1151955386 17:77377613-77377635 CTGGAGGCAGAGCAGGCTGTGGG + Intronic
1152069172 17:78126645-78126667 CTGGCTGCAGAGGGGGTTGGCGG + Exonic
1152069484 17:78127871-78127893 CTGGAGGGAGGGGGTGGTGTGGG - Intronic
1152088144 17:78232444-78232466 CAGCCGGAGGAGGGGGCTGTGGG + Intronic
1152199377 17:78936120-78936142 CTGTCGGCACAGGGGGCTGAAGG + Intergenic
1152457373 17:80424028-80424050 TTGGCGGGAGGGGGGCCTGGAGG - Intronic
1152494600 17:80662178-80662200 CTGACTGGAAAGGGGGCTGAGGG - Intronic
1152543111 17:80986973-80986995 TTGACGGGAGAGGGAGCTGGAGG + Intergenic
1152612674 17:81323301-81323323 GTGGACGCAGAGGGGGCTGTTGG + Intronic
1152690741 17:81716631-81716653 GGGGCGGGCGAGGTGGCTGTGGG + Intronic
1153040935 18:812358-812380 CTAGCGGGGGCGGGGGCTGCGGG + Intronic
1153717804 18:7868793-7868815 CTGGAGGAAGGGGTGGCTGTGGG - Intronic
1153798515 18:8647271-8647293 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1154981076 18:21502783-21502805 CTGGCGGGAGAGCTGGCAGAAGG - Intronic
1156022723 18:32618316-32618338 CTGGCGGGGGCGGGGGGAGTGGG - Intergenic
1156321240 18:36025418-36025440 CTGGGGGAAAAGGGGGTTGTGGG + Intronic
1156415087 18:36879624-36879646 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1157066499 18:44356782-44356804 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1157178820 18:45477578-45477600 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1157597226 18:48871210-48871232 CAGGAGGGTGAGGGGTCTGTGGG - Intergenic
1157614499 18:48978567-48978589 CAGGAGGGTGAGGGGTCTGTGGG + Intergenic
1157712993 18:49862894-49862916 CTGGCTGGGGAGGGGGGTGGGGG - Intronic
1157890451 18:51411111-51411133 CAGGCAGCAGAGGGGGCTGGAGG - Intergenic
1157916475 18:51668526-51668548 CTGTCGGGTGGGGGGGCGGTGGG + Intergenic
1158098679 18:53804699-53804721 CTGGCGGATGGGGCGGCTGTAGG + Intergenic
1158550339 18:58430603-58430625 CTGGTGGGAATAGGGGCTGTAGG + Intergenic
1158563734 18:58536654-58536676 CTTGCGGGTGAGTGGGCCGTGGG + Exonic
1158801941 18:60922151-60922173 ATAGAGGGAGAGGGGGCTGAGGG - Intergenic
1158853431 18:61518165-61518187 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1159123496 18:64196761-64196783 CTGGGTGGAGAGGAGGCGGTAGG + Intergenic
1159645756 18:70916352-70916374 CTGGGGGAAGAAGCGGCTGTGGG - Intergenic
1159690546 18:71482602-71482624 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1160354254 18:78213616-78213638 CTGGCGGCAGAGGGGCCTCGAGG - Intergenic
1160771231 19:832035-832057 TTGGTGGGGGAGGGGGCTGTGGG + Intergenic
1160794937 19:940906-940928 CTGGCGGGCGAGGGGTGGGTGGG + Intronic
1160883926 19:1336041-1336063 CCGGTGGGAGAAGGGGCTGGTGG + Intergenic
1161285213 19:3464873-3464895 CGGGCGGGGGAGGGGGTGGTCGG + Intronic
1161407356 19:4097995-4098017 CTGGCTGGAGAGGAGGAGGTGGG + Intronic
1161477390 19:4494143-4494165 CTGGAGGCGGAGGGGGCGGTTGG - Intronic
1161483905 19:4524677-4524699 GTGGGGGGAAAGGGGGGTGTTGG - Intronic
1161583808 19:5094472-5094494 CTGGCTGGAGAAGGGACTATGGG + Intronic
1161779206 19:6279914-6279936 CTGGCGGGCGAGCGGGCGGCCGG - Exonic
1161793866 19:6375591-6375613 CAGGCGGGCAAGGGGGCGGTGGG + Exonic
1162575728 19:11497750-11497772 TGGGCCGGAGAGGCGGCTGTGGG - Intronic
1162588946 19:11578389-11578411 CTGGGGGGAGGGGAGGGTGTGGG - Intronic
1162720320 19:12658142-12658164 CTGGAGGCAGAGGGGTATGTTGG + Intronic
1162729030 19:12706528-12706550 CGGGGGAGAGTGGGGGCTGTGGG + Intronic
1163528388 19:17835145-17835167 CTGGCTCGGGAGGGGGCTGATGG - Exonic
1163604672 19:18267415-18267437 CTGGGGTGAGCGGGGGCTGGAGG + Exonic
1165065499 19:33225898-33225920 GAGGTGGGGGAGGGGGCTGTGGG - Intergenic
1165108092 19:33486310-33486332 CTGGCAGGAGGGGTGGGTGTGGG - Intronic
1165750567 19:38256675-38256697 GTGGCGGGGTGGGGGGCTGTTGG + Intronic
1165855634 19:38878113-38878135 GTGGCAGGAGAGGAGGCTGTGGG + Intronic
1165945283 19:39437974-39437996 GTGAGGGGGGAGGGGGCTGTTGG + Intronic
1166147247 19:40846098-40846120 CTGCAGGGAGAGGGGGCTTTAGG + Intronic
1166151399 19:40877994-40878016 CTGCAGGGAGAGGGGGCTTTAGG + Intronic
1166155892 19:40910688-40910710 CTGCAGGGAGAGGGGGCTTTAGG + Intergenic
1166327273 19:42058978-42059000 ATGGGGAGAGAAGGGGCTGTGGG - Intronic
1166394937 19:42432710-42432732 GTGGGGGTAGATGGGGCTGTTGG - Intronic
1166790726 19:45396912-45396934 CTTGGGGGACAGCGGGCTGTAGG + Exonic
1166981535 19:46634710-46634732 CGCGCGGGAGTGGGGGCTGTGGG + Intergenic
1167006926 19:46782356-46782378 GTGGTGGGAGAGGAGGCTGGGGG - Intronic
1167124024 19:47537068-47537090 CTGGGGGAAGAAGGGACTGTGGG + Intronic
1167129228 19:47573328-47573350 CGGGCGGGAAAGGAGGCGGTTGG + Intergenic
1167322469 19:48805628-48805650 ATGGCGGGAGAGGGGACAGTTGG - Intronic
1167427458 19:49436840-49436862 CTTGGGGGTGAGGGGGCTGGGGG - Intronic
1167502698 19:49856689-49856711 CTGGCGGCAGGGGGTGATGTGGG + Intronic
1167738708 19:51311764-51311786 CTGGGGGGAGAGGGGGGAGGGGG - Intergenic
1167974059 19:53209897-53209919 CTGGGGGAAGAGGCGGCTGTGGG - Intergenic
1168530806 19:57127377-57127399 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1168670038 19:58234104-58234126 CAGGCTGGAGAGTGGACTGTGGG - Intronic
925056978 2:863781-863803 CTGGGGGCAGTGGGGGCTGGGGG - Intergenic
925172637 2:1759662-1759684 CAGGCGGGAACCGGGGCTGTGGG - Intergenic
925362122 2:3286841-3286863 CAGCCGGCAGAGGGGGCTGTGGG + Intronic
925362143 2:3286917-3286939 CAGCCGGCAGAGGGGGCGGTGGG + Intronic
925362154 2:3286955-3286977 CAGCCGGCAGAGGGGGCGGTGGG + Intronic
925566330 2:5258286-5258308 CTGGCAGAAGAGGTGGCTATGGG - Intergenic
925618210 2:5764416-5764438 CTGGCGGGAGAGGAGATGGTGGG + Intergenic
925729062 2:6904416-6904438 CTGGCGGGAGGAGCGGCTGTGGG - Intergenic
925751714 2:7095463-7095485 CTGCAGGGAGAGGAGGCTGGGGG + Intergenic
925929340 2:8694266-8694288 CTGGTGGGGGAGAGGGCTGGGGG + Intergenic
926943924 2:18167787-18167809 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
927182841 2:20459151-20459173 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
927477311 2:23423647-23423669 CTGGCGGGCGGGGGTCCTGTGGG + Intronic
927860389 2:26557029-26557051 CAGGAGGGAGAGGGAGGTGTGGG - Intronic
928106124 2:28471700-28471722 CTGGCCAGGGCGGGGGCTGTGGG - Intronic
928511930 2:32010596-32010618 CTGGGAGGGGAGGGGGCCGTGGG - Intronic
929064694 2:37962287-37962309 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
929446809 2:42008603-42008625 CTGGGGGCACAGGGAGCTGTTGG - Intergenic
929838063 2:45426395-45426417 CTGGCGGAAGGCGTGGCTGTGGG + Intronic
930048417 2:47194221-47194243 CTGGTAGGAGGGGGAGCTGTAGG - Intergenic
930860300 2:56065145-56065167 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
931515871 2:63050533-63050555 CTGGCCGCGGAGGGGGCCGTGGG - Intronic
931516105 2:63051488-63051510 GAGGCGGGGGAGGGGGCTGCGGG - Intronic
932051857 2:68405740-68405762 CTGGGTGAAGAGGTGGCTGTGGG + Intergenic
932208425 2:69906101-69906123 CTGGCGGGAGAGGTTGCAGTGGG - Intronic
932306311 2:70706187-70706209 CGGGCGGGAGAGGGCGCAGGGGG - Intronic
932523381 2:72437493-72437515 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
933317939 2:80737347-80737369 CTGGGGGGAGGGGTGGCTGTGGG + Intergenic
934588530 2:95526719-95526741 CTGGGGGAAGAGGCGGCTGGCGG + Intergenic
934655874 2:96116626-96116648 CGGGCGGGAGGCGGGGCGGTGGG + Intergenic
935010895 2:99135177-99135199 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
935695388 2:105766696-105766718 CTGGCGGGGGCGGGGTCTGCAGG + Intronic
935961542 2:108429990-108430012 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
936444665 2:112586193-112586215 CTGGCGGATGATTGGGCTGTGGG - Exonic
936919344 2:117671521-117671543 CTGTCTGAAGAGGGTGCTGTGGG - Intergenic
937220301 2:120339304-120339326 CTGGAGGGGGTGTGGGCTGTTGG + Intergenic
937307627 2:120881841-120881863 CAGGTGGGAGAGGGGCATGTGGG + Intronic
937395338 2:121530123-121530145 AGGGAGGGAGAGGGGGCTGGAGG + Intronic
937526174 2:122772619-122772641 CTGGGGGAAGGGGTGGCTGTAGG + Intergenic
937573570 2:123392220-123392242 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
937724778 2:125149726-125149748 GTGGGGGGATAGGGGGCTGGGGG - Intergenic
938018197 2:127885401-127885423 CGGGCGGGGGAGGGGGCGGCGGG + Intronic
938230819 2:129657298-129657320 GTGGCGGGGGAGGGGGTTGCGGG - Intergenic
938406425 2:131035472-131035494 CTGTGGGGAGTGGGGGCTGCGGG + Intronic
939116856 2:138070935-138070957 CAGGGGGAAGAGGTGGCTGTGGG - Intergenic
939640793 2:144638267-144638289 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
939876643 2:147586055-147586077 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
940030500 2:149257243-149257265 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
940038278 2:149331466-149331488 GGGGCGGGAGAGGGGACTGGAGG - Intronic
940420981 2:153478804-153478826 CTCGCTCGAGGGGGGGCTGTTGG + Exonic
940565107 2:155351137-155351159 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
940930531 2:159423874-159423896 GTGGCGGGGGATGGGGCTGAAGG + Intronic
941276632 2:163498230-163498252 CTGGCGGAAGGGGTGGCTGTGGG + Intergenic
942411093 2:175709654-175709676 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
943094926 2:183417146-183417168 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
943166105 2:184328004-184328026 CGGGCGGGAACTGGGGCTGTGGG - Intergenic
944169387 2:196758209-196758231 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
944414237 2:199467383-199467405 TTGGGGGGAGGGGAGGCTGTTGG - Intronic
944943233 2:204652985-204653007 GTGTCGGGAGAGGGGCCTGGTGG - Intronic
945409842 2:209495230-209495252 CTGGGGGAAGAGGGGGATGTGGG + Intronic
945486843 2:210406792-210406814 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
945490205 2:210446005-210446027 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
945945250 2:215988938-215988960 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
946026782 2:216676692-216676714 CTGGCTGGAGTCGGGGCTGGGGG + Exonic
946182805 2:217959068-217959090 CTGTGCGGGGAGGGGGCTGTTGG + Intronic
946428261 2:219611440-219611462 GTGCCGGGAGAGGGAGCTGGTGG + Intronic
946509215 2:220335808-220335830 CTGCCGGGGGATGGGGCTGGTGG + Intergenic
946790178 2:223293228-223293250 CTGGCGGAAGGGGCAGCTGTGGG - Intergenic
947100318 2:226613952-226613974 ATGGCAGGATTGGGGGCTGTAGG + Intergenic
948094291 2:235321298-235321320 CTGGCCAGTGCGGGGGCTGTGGG + Intergenic
948106693 2:235420155-235420177 CTTGCTGGAGAGGTGGGTGTTGG - Intergenic
948385566 2:237578545-237578567 CTGGCAGGCGAGGGGCCGGTAGG - Intronic
948515606 2:238501518-238501540 CTGGTGTGAGAGGTGGCTGTTGG - Intergenic
948758250 2:240171981-240172003 GTGGAGGGAGAGGGGTCTGGAGG + Intergenic
948865603 2:240773258-240773280 TGGGTGGCAGAGGGGGCTGTGGG + Intronic
948943530 2:241208071-241208093 CAGGCGGGAGGGGGGACAGTGGG - Intronic
949050812 2:241896476-241896498 ATGGCGGGGGAAGGGGGTGTGGG + Intronic
1168878031 20:1184904-1184926 CCGGCGGGAGCGGGCGCGGTGGG - Intronic
1168892440 20:1303660-1303682 CTGGAGGGACTGGGGGCTGAGGG - Intronic
1168980979 20:2003231-2003253 CTGGCTGGAGATGGGGGTGATGG + Intergenic
1169267571 20:4175889-4175911 CTGGCGGGGGAGGGGGTGGGGGG + Intronic
1169383210 20:5126831-5126853 CTCCCGGGAGAGGGAGCTCTCGG + Exonic
1169605921 20:7319180-7319202 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1170720397 20:18872997-18873019 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1170844350 20:19949687-19949709 CTCGCGGGAGCGGGTGATGTAGG + Intronic
1171011952 20:21513744-21513766 CGGGCGGGGGAGGGGGGAGTTGG + Exonic
1171375899 20:24694024-24694046 GTGGCGGGAGAGAGGCCTCTTGG + Intergenic
1172503417 20:35443311-35443333 CTGACAGGAGAGGGGGAGGTTGG - Intronic
1172703492 20:36866140-36866162 CTGGCCAGGGAGGGGCCTGTGGG + Intergenic
1172808658 20:37631761-37631783 AGGGAGGGAGAGGGGGCTGCTGG - Intergenic
1173282192 20:41638844-41638866 CTGGAGGCAGAGGGGACTCTAGG - Intergenic
1173606590 20:44336261-44336283 CTGGAAGGGGAGGGGGCTGTGGG + Intergenic
1173671252 20:44800580-44800602 CTGGCAGGAGGGGGCGCTCTGGG + Intronic
1173733368 20:45343461-45343483 CTGGAGGGAGAGGGGGCAGGGGG - Intronic
1173873793 20:46357367-46357389 CTGGCAGGAGAGGGAGCTGCGGG + Intronic
1174352950 20:49981499-49981521 CTAGCTGGAGAGCGGGCAGTAGG - Intergenic
1174404316 20:50293795-50293817 CTGGCGGGAGTGGGGCCTCCTGG + Intergenic
1175769366 20:61613847-61613869 TTGGTGGGAGGGGGGGCTTTGGG + Intronic
1175862025 20:62155672-62155694 CTGGCAGGAGATGGGGTTGGAGG - Intronic
1176160012 20:63642993-63643015 CTGGTGGGAGGGGAGGCTGCAGG + Intronic
1176196815 20:63840721-63840743 CTGGAGGGAGGTGGGGCTCTGGG + Intergenic
1176300322 21:5096190-5096212 CTTGAGGGTGAGGGGCCTGTGGG - Intergenic
1176428082 21:6560910-6560932 CTGGCGGTAGTAGGGGCTGATGG - Intergenic
1177050327 21:16225148-16225170 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1177136425 21:17309163-17309185 CTGGGGGAAGATGTGGCTGTGGG + Intergenic
1177184142 21:17775337-17775359 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1177694624 21:24555381-24555403 CTGGAAGGAGGGGTGGCTGTGGG + Intergenic
1178393617 21:32220021-32220043 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1178622397 21:34188026-34188048 CCAGGGGGAGAGGGAGCTGTGGG + Intergenic
1178839897 21:36130118-36130140 CTGGGAGGGGAGGGGGCCGTGGG + Intergenic
1178864393 21:36316268-36316290 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1179286210 21:39979405-39979427 CTTGGTGGAGAGGGGGCTGGAGG + Intergenic
1179505800 21:41839538-41839560 CTGGCGGGGCAGGGGGCAGAGGG - Intronic
1179626610 21:42652992-42653014 CGGGAGGGGAAGGGGGCTGTGGG - Intergenic
1179703573 21:43169227-43169249 CTGGCGGTAGTAGGGGCTGATGG - Exonic
1179797272 21:43792489-43792511 CTGGCTGTAGAGGGGTCTTTTGG + Intronic
1179856701 21:44165721-44165743 CTTGAGGGTGAGGGGCCTGTGGG + Intergenic
1179974278 21:44855111-44855133 GTGGCCTGAGATGGGGCTGTGGG - Intronic
1180058276 21:45370947-45370969 CAGGAGGGAGAGGGGGCCCTGGG + Intergenic
1180654493 22:17408198-17408220 CTGGGGGGTGAGGGGGCTGAGGG - Intronic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1181630180 22:24147074-24147096 CTGGGGGCAGAGGGGGCTGTGGG - Intronic
1182278338 22:29204393-29204415 CTGGAGGGAGAGGGAGCCCTTGG + Intergenic
1183423116 22:37723718-37723740 CTGTTGGGAGAGGAGGCTCTGGG - Exonic
1183423270 22:37724456-37724478 CTGTTGGGAGAGGAGGCTCTGGG - Exonic
1183423302 22:37724600-37724622 CTGCTGGGAGAGGAGGCTCTGGG - Exonic
1183442336 22:37830289-37830311 GAGGCGGCAGAGGGAGCTGTGGG - Intergenic
1183709165 22:39492327-39492349 CAGTGGGGAGAGGGGGCTGCAGG + Intergenic
1184224511 22:43121479-43121501 CTGCTGGGTAAGGGGGCTGTGGG + Intronic
1184237220 22:43189439-43189461 CTGGAGGGGGAGGGGGTTGGTGG - Intergenic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184726703 22:46351384-46351406 ATGGAGGGCGAGGGCGCTGTGGG + Intronic
1184915127 22:47563840-47563862 CTGGCTGGAGAGGGGTCAGGAGG + Intergenic
1184991544 22:48173599-48173621 CTGGAGGGAGAGGGGTGTGATGG + Intergenic
1185063984 22:48621493-48621515 CTGGCCGGGGTAGGGGCTGTTGG + Intronic
949946445 3:9193550-9193572 CTGGCGGGAGATGGGGATCCTGG + Intronic
950521110 3:13498604-13498626 CTGGCCTGAAAGGGGGCTGGGGG + Intronic
950597401 3:13996875-13996897 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
950667559 3:14506401-14506423 CTGGGGTGGGAGGGGGCTTTTGG + Intronic
950924962 3:16731228-16731250 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
950992079 3:17449777-17449799 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
951368132 3:21810369-21810391 CTGTCGGGGGTGGGGGCTGGGGG + Intronic
951434210 3:22643197-22643219 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
951826722 3:26876390-26876412 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
952392601 3:32893184-32893206 TTGGGGGGAGAGGGGGCGGGGGG - Exonic
952708597 3:36406142-36406164 CTGGGTGGGGAGGGGGCTGAGGG - Intronic
952925323 3:38315721-38315743 CTGGTGGGCGAGGGGGCCATGGG + Intronic
953102296 3:39842052-39842074 CTGGGGGGAGGGGCGGCTGTGGG - Intronic
953843190 3:46406437-46406459 CTGTGGGGAGGGGAGGCTGTGGG - Intergenic
954106943 3:48414642-48414664 GTGGGGGCAGAGGGGGCTGGTGG - Intronic
954112233 3:48440480-48440502 CTGGCGGGTGCGGGGGCGCTGGG + Intronic
954390220 3:50264777-50264799 GTGGGAGGAGAGGGGGCTGGGGG - Intergenic
954416528 3:50396027-50396049 CTGGGGAGAGAGGAGGGTGTGGG - Intronic
954508143 3:51097201-51097223 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
954795858 3:53161138-53161160 CTGGCGGGGGCGGGGCCTGGCGG + Exonic
955145498 3:56314230-56314252 CTTGCGGAGGTGGGGGCTGTGGG + Intronic
955414244 3:58678196-58678218 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
955447861 3:59032743-59032765 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
955563655 3:60221436-60221458 CTGACTGGAGAATGGGCTGTAGG - Intronic
955687691 3:61562585-61562607 CTGGCCGGGGAGGGGGCTGGGGG + Intronic
958793635 3:98682417-98682439 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
959881152 3:111446701-111446723 CTGGGGGAAGAGGTGGCTGTGGG - Intronic
960540026 3:118851668-118851690 CTGTTGAGAGAGGGGGCTGAGGG + Intergenic
960573344 3:119206455-119206477 CTAGCTGGAGAGGGGGCAGGGGG - Intergenic
960768688 3:121167726-121167748 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
960776568 3:121262863-121262885 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
961015716 3:123466725-123466747 CTGGTGGCAGTGGGGGTTGTGGG - Intergenic
961977568 3:131042656-131042678 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
962666096 3:137654742-137654764 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
964049434 3:152372893-152372915 CTGGCGGAAGAGGCGGCTGTGGG - Intronic
964053146 3:152420153-152420175 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
965017288 3:163174254-163174276 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
965602323 3:170467470-170467492 CTGGCGGGGTGGGGGGCGGTGGG + Intronic
965621895 3:170650755-170650777 CTGGTGGGAGGGGCGGCTGTGGG - Intronic
965880506 3:173382697-173382719 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
966172240 3:177095205-177095227 CTAGGGGGAGAGGGGGGTGTTGG + Intronic
966255189 3:177909013-177909035 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
966637863 3:182156302-182156324 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
966820538 3:183920724-183920746 GAGGCGGCAGAGGGGGCTGTCGG + Exonic
967419518 3:189258598-189258620 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
967562614 3:190934606-190934628 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
967779275 3:193418558-193418580 CTGGCTAGAGAGTGGGGTGTTGG - Intronic
968478227 4:822604-822626 CTGGCAGGAGAGGGAGCAGGAGG - Intronic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
968643341 4:1726121-1726143 CTGACAGAAGAGGCGGCTGTTGG - Intronic
968665063 4:1816481-1816503 GCGGGAGGAGAGGGGGCTGTGGG + Intronic
968726056 4:2248296-2248318 CTGCCGGGAGGGTGGGCTGAGGG + Exonic
968901786 4:3435525-3435547 CTCTAGGGAGAGGGGGCTCTGGG - Intronic
968901803 4:3435573-3435595 CTGGGGGGAGACAGGGCTCTGGG - Intronic
969046301 4:4339178-4339200 CTGGCCGGAGGGAGGGGTGTTGG - Intergenic
969308660 4:6339738-6339760 CTGGAGGGGGAGGGGCCTATGGG + Intronic
969481714 4:7449888-7449910 CTGGCGGGAGAGGTGGGAGCTGG + Intronic
969827326 4:9767846-9767868 CTGAAGGGAGATGGGGCTGTAGG - Intergenic
970132358 4:12885653-12885675 GTGGGTGGGGAGGGGGCTGTCGG - Intergenic
970685292 4:18559963-18559985 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
971430013 4:26556110-26556132 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
971697930 4:29930184-29930206 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
972380579 4:38516012-38516034 CGGGCGGGGGGGGGGGGTGTTGG - Intergenic
972962799 4:44474257-44474279 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
973081802 4:46002869-46002891 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
973137297 4:46724365-46724387 GTGGTGGGAGACGGAGCTGTAGG - Intergenic
973230830 4:47837482-47837504 CTGGCGGCAGGGGAGGCTGCAGG - Intronic
973288532 4:48446464-48446486 GGGGTGGGAGAGGGGGATGTGGG - Intergenic
974263929 4:59560201-59560223 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
974453259 4:62093941-62093963 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
974975426 4:68885842-68885864 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
975424926 4:74214802-74214824 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
975479370 4:74860344-74860366 CTGGTGGAAGGGGTGGCTGTGGG + Intergenic
976394963 4:84545499-84545521 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
976412621 4:84733528-84733550 GTTGAGGGAGCGGGGGCTGTGGG - Exonic
976655872 4:87488683-87488705 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
976698322 4:87942008-87942030 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
977723431 4:100267369-100267391 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
977996067 4:103498372-103498394 GTGGTGGGGGAGGGGGTTGTGGG - Intergenic
978108324 4:104931105-104931127 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
978139113 4:105297506-105297528 CTGGAGGAAGGGGTGGCTGTTGG + Intergenic
978278281 4:106978335-106978357 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
978295810 4:107203881-107203903 GTGGTGGGAGACGGAGCTGTAGG - Intronic
978477210 4:109144491-109144513 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
979043736 4:115834804-115834826 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
979253443 4:118588669-118588691 CTGGCAGCAGAAGGGGCTGGGGG - Intergenic
979302225 4:119100194-119100216 CTGTCGGGGGAGGGGGCTAGGGG - Intergenic
979461566 4:120990290-120990312 CTGAGGGAAGTGGGGGCTGTAGG - Intergenic
979998657 4:127463746-127463768 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
980100266 4:128535463-128535485 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
980200638 4:129652051-129652073 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
980494124 4:133569917-133569939 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
981553685 4:145967991-145968013 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
981749917 4:148083121-148083143 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
981859800 4:149341130-149341152 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
982323928 4:154109327-154109349 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
982393676 4:154892523-154892545 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
982725550 4:158902579-158902601 CTGGGGGAAGGGGCGGCTGTAGG - Intronic
982733223 4:158978964-158978986 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
982794494 4:159629308-159629330 CTGGGGGAAGCGGCGGCTGTGGG - Intergenic
982825780 4:160002198-160002220 CTGGGGGAAGGGGCGGCTGTAGG + Intergenic
983179497 4:164630987-164631009 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
983939636 4:173525999-173526021 CAGGCGGGAAAGGGGGGTGGAGG - Intronic
984711972 4:182893472-182893494 ATGGAGGGAGTGGGGGCTGCTGG + Intronic
985640624 5:1061982-1062004 CTGGCTGGAGAGGGGCGTCTGGG - Intronic
985989081 5:3540197-3540219 CTGGCTGCAGAGGAGGCTGGTGG + Intergenic
986344563 5:6822857-6822879 CTGGTGGGACAGGGCGCTGTGGG - Intergenic
986702365 5:10423161-10423183 GTGGTGGGGAAGGGGGCTGTGGG + Intronic
987528153 5:19080274-19080296 CTGGGGGAAGAGGTGGTTGTGGG - Intergenic
987687637 5:21225803-21225825 CTGGGGGAAGCGGTGGCTGTGGG + Intergenic
988402160 5:30775981-30776003 CTGGGGGAAGGGGTGGCTGTTGG + Intergenic
989675192 5:43965547-43965569 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
989825381 5:45848327-45848349 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
990803557 5:59632288-59632310 CTGGGGGGAGGGGTGGCTTTGGG + Intronic
991128181 5:63090841-63090863 CTGGGGGAAGGGGCGGCTGTCGG + Intergenic
991223619 5:64243635-64243657 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
991242379 5:64474600-64474622 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
991674325 5:69076201-69076223 CTGCAGGAAGAGGGGCCTGTGGG - Intergenic
992038823 5:72808623-72808645 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
992063013 5:73075640-73075662 CTGGGGGCAGAGGGTGCGGTGGG + Intronic
992071052 5:73149719-73149741 CTGCCTGGAGTCGGGGCTGTGGG + Intergenic
992292392 5:75292838-75292860 CTGGTGGAAGGGGTGGCTGTGGG - Intergenic
992614476 5:78535484-78535506 CTGGTGGGAGAGGGGGTCCTAGG - Intronic
992625863 5:78635373-78635395 CTGGGGGAAGAGGGGGCGGTGGG - Intronic
992977652 5:82137812-82137834 CTGGGGGAAGAGGTGGCAGTGGG - Intronic
993403989 5:87488356-87488378 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
993911607 5:93690599-93690621 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
994137909 5:96309052-96309074 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
994378131 5:99038150-99038172 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
994721512 5:103385763-103385785 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
995136524 5:108685709-108685731 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
995471269 5:112504134-112504156 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
995475090 5:112539498-112539520 CCTGGGGGAAAGGGGGCTGTGGG + Intergenic
995599176 5:113777124-113777146 CTGGCCGGAGAGGTGGCTCAAGG + Intergenic
995695792 5:114876765-114876787 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
996280682 5:121726304-121726326 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
996420663 5:123258731-123258753 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
996648108 5:125841239-125841261 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
997171759 5:131729279-131729301 CTGGAGGAAGGGGTGGCTGTTGG - Intronic
997216703 5:132117306-132117328 CTGGAGGAAGAGGCGGCTGTGGG + Intergenic
997470203 5:134113307-134113329 GTGGCGGGGGAGGGGGGTGTGGG + Intergenic
997902806 5:137783499-137783521 CTGGGGGAAGAGGTGGCTGTGGG + Intergenic
998174805 5:139895186-139895208 CTCCTGGCAGAGGGGGCTGTGGG - Intronic
998392410 5:141795742-141795764 CTGGCTGGGGAGGGGTCTCTAGG - Intergenic
998397136 5:141826008-141826030 CTCTCGGGAGATGGAGCTGTTGG + Intergenic
998691568 5:144594335-144594357 CTGGGGGGAGGGGCGGCTGTGGG - Intergenic
999243694 5:150141966-150141988 CTGCAGGGAGAGGGGGGTGCTGG + Intronic
999488672 5:152026602-152026624 CTAGGGGAAGAGGTGGCTGTGGG - Intergenic
999489787 5:152038894-152038916 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1000352435 5:160362473-160362495 CACTCAGGAGAGGGGGCTGTGGG - Intronic
1000798328 5:165693006-165693028 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1000820146 5:165973266-165973288 CTGGGGGAAGGGGTGGCTGTAGG - Intergenic
1000996050 5:167960290-167960312 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1001034294 5:168286523-168286545 CTGGTGGGAGACGGGGGTGGGGG - Intergenic
1001346337 5:170903094-170903116 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1001362618 5:171103195-171103217 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1001489658 5:172146470-172146492 AAGGAGGTAGAGGGGGCTGTGGG - Intronic
1001519660 5:172381980-172382002 CTGGCAGGAGGGAGGGCTGTGGG + Intronic
1001562343 5:172677831-172677853 GTGGCTGGTGAGGGGGCTGATGG - Intronic
1001592531 5:172875445-172875467 CTGGGGGGGTAGGGGGCTTTTGG - Intronic
1002080287 5:176733534-176733556 CGGACGGGAGATGGGGCTGGGGG - Intergenic
1002461891 5:179378015-179378037 CTGGCTGGAAAGGAGGCTTTGGG - Intergenic
1002574992 5:180169564-180169586 CAGCTGGGAGAGGGGGCTGGGGG + Intronic
1002673582 5:180890243-180890265 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1002685837 5:181008557-181008579 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1002926321 6:1607727-1607749 CTGGTGGGGGAGGGGGCAGCGGG + Intergenic
1002996169 6:2287071-2287093 CTGGGGGAAGAGGTGGCTGTGGG + Intergenic
1003315901 6:5011553-5011575 CAGGCGGGAGCTGGGGCTGGCGG + Intergenic
1003416839 6:5917440-5917462 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1004028040 6:11837739-11837761 CTGGTGGGAGGGGCAGCTGTGGG + Intergenic
1004168034 6:13274105-13274127 CGGGCGGGGGTGGGTGCTGTAGG - Intronic
1004203878 6:13574266-13574288 CCGGCTGGAGAGGAGGCCGTGGG - Intergenic
1004207025 6:13600963-13600985 CTGATGGGAGAGGGAGATGTGGG + Intronic
1004690191 6:17987189-17987211 CTGGCGGGCGGGCGGGCTGGAGG - Intronic
1004809048 6:19239231-19239253 CTGGTGGAAGAGGTGGCTGTGGG + Intergenic
1005826133 6:29632777-29632799 GTGGTGGGGGAGGGGGCAGTGGG - Intronic
1005966591 6:30730983-30731005 CCGGCGGGAGAAGGAGCTGGAGG - Exonic
1006117189 6:31781647-31781669 TTGGCGGGACAGGGGACTGGAGG - Intronic
1006171953 6:32098069-32098091 CTGGCTGGGGAGGGGGCCGGGGG + Intronic
1006200016 6:32279759-32279781 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1006295203 6:33167178-33167200 CTGGAGGAAGTGGAGGCTGTTGG - Intronic
1006333663 6:33409967-33409989 GAGGCGGGAGCGGGGGCTGAGGG + Intergenic
1006383196 6:33712916-33712938 CTGGGGGGAGAGGGGGAAATGGG - Intergenic
1006440963 6:34053418-34053440 GGGGCGGGTGAGGGGGCTGCTGG - Intronic
1006444880 6:34074533-34074555 CTGCCAGGAGAGGAGGCTGCTGG + Intronic
1006799128 6:36748298-36748320 CTGGAGGGAGGCAGGGCTGTGGG + Intronic
1007109441 6:39304479-39304501 CTGGCAGGTGAGGGGGCTGCTGG - Exonic
1007330247 6:41101218-41101240 CCTGCGGGAGAGGCGGCCGTTGG + Intergenic
1007431354 6:41779297-41779319 CAGGAGTGAGAGGGGGGTGTGGG + Intronic
1007473256 6:42104297-42104319 TTACCGGGAGAGGGCGCTGTTGG - Intronic
1007656718 6:43455271-43455293 GTGGCGGGGGGGGGGGCTGTCGG - Intronic
1007761264 6:44134994-44135016 CTGAGGGAAGAGGGGGCAGTTGG - Intronic
1008896790 6:56565793-56565815 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1009455314 6:63849232-63849254 CTGGGGAGAGGGGTGGCTGTGGG + Intronic
1009880557 6:69561015-69561037 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1010039097 6:71360915-71360937 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1011086537 6:83547014-83547036 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1011174151 6:84541359-84541381 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1011277426 6:85643690-85643712 CTGGCGGGGCAGAGTGCTGTGGG + Intronic
1011300615 6:85868965-85868987 GTGGTGGGAGATGGAGCTGTAGG + Intergenic
1011797683 6:90975071-90975093 GAGGTGGGAGAGGGAGCTGTTGG + Intergenic
1012207417 6:96478499-96478521 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1012838827 6:104303570-104303592 CTGGCGGGGGTGGGGGATCTTGG + Intergenic
1013025088 6:106263387-106263409 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1013272577 6:108558149-108558171 CTGGCGGGGTAGGGGGCGCTAGG - Intergenic
1013507566 6:110815227-110815249 CGCGCGCGAGAGGCGGCTGTTGG - Exonic
1013920096 6:115394181-115394203 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1014495995 6:122123516-122123538 CTGGCAGGAGAGGTGATTGTAGG + Intergenic
1014691090 6:124564482-124564504 CTGGTGGGGGAGGGGGGGGTTGG - Intronic
1014922482 6:127229033-127229055 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1015471918 6:133615142-133615164 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1016386665 6:143536770-143536792 CTGGAGCGAGAGCCGGCTGTAGG + Intergenic
1016418345 6:143857029-143857051 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1016447797 6:144150657-144150679 CTGCCGGGAGAGGGGCTTCTCGG + Exonic
1016855972 6:148671184-148671206 CTGGGGGAAGGAGGGGCTGTGGG - Intergenic
1016985792 6:149895004-149895026 CTGGCAGCAGAGGGGCCTGATGG - Intronic
1017234012 6:152100427-152100449 CTGGCAGGAGTGGAGGCGGTAGG - Exonic
1017322684 6:153111486-153111508 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1017571461 6:155749133-155749155 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1017916381 6:158835086-158835108 CTGGCGGGAGAGGGCTCTGGAGG - Intergenic
1018863169 6:167726939-167726961 CAGGAGGCAGAGGAGGCTGTGGG + Intergenic
1019126919 6:169846641-169846663 CTGGCTGCAGAGGAGCCTGTGGG + Intergenic
1019437834 7:1031069-1031091 CTGCTGGGGGAGGGGGCTCTAGG - Intronic
1019749400 7:2719243-2719265 CAGGCGGGAGAGGCGGCCGGAGG - Intronic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1019779248 7:2929888-2929910 CTGGAGGGAGAGTGGGTGGTGGG + Intronic
1020235039 7:6348774-6348796 AGGGCGGGCGGGGGGGCTGTGGG - Exonic
1020639949 7:10742466-10742488 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1020884404 7:13803952-13803974 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1021166952 7:17354039-17354061 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1021749295 7:23779434-23779456 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1021916220 7:25435312-25435334 GGGGTGGGAGAGGGGGCTTTGGG - Intergenic
1021968438 7:25944958-25944980 CTGGGGGGAGCTGAGGCTGTAGG - Intergenic
1022503315 7:30895924-30895946 CTGGCAGGAGAGTGGGGTGTGGG + Intergenic
1022848423 7:34235230-34235252 CTGGCGGAAGAGGCTGCTGTGGG - Intergenic
1023051701 7:36258421-36258443 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1023523465 7:41072729-41072751 GGGGCGGGGGGGGGGGCTGTAGG + Intergenic
1023697716 7:42865026-42865048 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1023865577 7:44236702-44236724 CAGACAGGAGAGGGGACTGTGGG - Intronic
1023867009 7:44243066-44243088 CTGGGTGGAAAGGGGGCTCTTGG + Intronic
1024465869 7:49711264-49711286 CTGGCGGGAACCGGGGCTGCGGG + Intergenic
1024703307 7:51928081-51928103 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1024998470 7:55294508-55294530 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1025301417 7:57821875-57821897 GGCGTGGGAGAGGGGGCTGTGGG - Intergenic
1025714496 7:63942113-63942135 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1026159099 7:67852969-67852991 CTGGAGGGAGAAGGGGATGAGGG + Intergenic
1026488194 7:70838719-70838741 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1027510302 7:79071544-79071566 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1027582937 7:80020668-80020690 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1028337371 7:89674083-89674105 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1028523686 7:91759625-91759647 CTGGGGGAAGGGGAGGCTGTGGG + Intronic
1028773576 7:94655687-94655709 CTGGGCGGGGAGGGGGATGTTGG + Intronic
1028945556 7:96575562-96575584 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1028985627 7:97006451-97006473 CGGGCGGGGTAGGGGGCAGTCGG - Intronic
1029113997 7:98228117-98228139 CTGTGGGGAGAGGTGGCTGCTGG + Intronic
1029547064 7:101216211-101216233 CTGGCCCGAGTGGGGGCTGGCGG - Exonic
1030159589 7:106493418-106493440 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1030245215 7:107377842-107377864 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1030612581 7:111705798-111705820 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1030705587 7:112689760-112689782 CTGGGGGAAGAGGCGGCTGTGGG - Intergenic
1030801388 7:113856815-113856837 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1030859991 7:114613789-114613811 CTGGTGGTAGTGGGTGCTGTAGG - Intronic
1031002933 7:116438370-116438392 CTGGAGAAAGAGGGGGCTGTGGG + Intronic
1031200674 7:118681066-118681088 TTGGCGGGAGTGGGGGGTGCAGG - Intergenic
1031899252 7:127392129-127392151 CTGGCGTGGGAGGCGGCTGCGGG + Intronic
1032283399 7:130523954-130523976 CTGGCGGGGCAGGGGGATGAGGG + Intronic
1032295874 7:130638320-130638342 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1033306771 7:140230913-140230935 CTGGGGGGCGTGGGGGCCGTAGG + Intergenic
1033402454 7:141039492-141039514 CTGGAGGGAGAGTAGGCTGGAGG - Intergenic
1033617710 7:143032557-143032579 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1033680094 7:143584940-143584962 CTGGAAGGAGGGGTGGCTGTGGG + Intergenic
1033691741 7:143744502-143744524 CTGGAAGGAGGGGTGGCTGTGGG - Intergenic
1034313607 7:150110823-150110845 CTGGCAGGGGGGTGGGCTGTTGG + Intergenic
1034413503 7:150953414-150953436 CTGTGTGGAGAGGGGGCTGAGGG - Intronic
1035228238 7:157445339-157445361 CTGCAGGGGGTGGGGGCTGTGGG + Intergenic
1035401777 7:158570417-158570439 ATGGTGGGAGAGGGTGCTGGAGG - Intronic
1035601950 8:902344-902366 TTGGCGGGCGCGGGGGCTGGGGG + Intergenic
1036553834 8:9839220-9839242 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1037285418 8:17294047-17294069 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1037584754 8:20268756-20268778 CTGGGGGGAGAGGCTGCTGGTGG + Intronic
1038651689 8:29409656-29409678 TTGGCGGGGGAGGGGGATGCGGG + Intergenic
1039283029 8:36006956-36006978 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1040736603 8:50515848-50515870 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1041012355 8:53557733-53557755 TTGGGGGGAGCAGGGGCTGTGGG + Intergenic
1041155108 8:54977432-54977454 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1041459691 8:58098138-58098160 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1042110979 8:65380490-65380512 CTGGGGGAAGAGGTGGCTGTGGG + Intergenic
1042349401 8:67761661-67761683 CTGGAGGAAGAGGCAGCTGTGGG + Intergenic
1042627109 8:70770508-70770530 CTGGAGGAAGATGCGGCTGTGGG - Intronic
1043970965 8:86527735-86527757 GTGGAGGGAAAGGGGGCTTTGGG + Intronic
1044509420 8:93058093-93058115 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1045783733 8:105897517-105897539 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1045797752 8:106065616-106065638 CTGGGGGAAGAGGCAGCTGTGGG + Intergenic
1045973383 8:108104329-108104351 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1046047923 8:108986157-108986179 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1046277861 8:111986121-111986143 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1046972491 8:120238202-120238224 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1047116072 8:121842961-121842983 CTTGGGGGGAAGGGGGCTGTTGG + Intergenic
1047121356 8:121908463-121908485 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1047369531 8:124245139-124245161 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1047781135 8:128112061-128112083 CTGGCAAGAGAGTGGGCTGAAGG - Intergenic
1048150053 8:131885431-131885453 CTGGAGGGAGAGGCTGCTGGGGG - Intergenic
1049196949 8:141320936-141320958 CTGGGGAGAGAGCGGGCTGTTGG + Intergenic
1049411760 8:142476701-142476723 CTGGCGGGAGGGGGGTGGGTGGG + Intronic
1049427058 8:142542403-142542425 CTGGCGGGAGGGCGGGCTGCGGG - Exonic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049641066 8:143716266-143716288 CTGCCGGGGGCGGGGGGTGTTGG + Exonic
1049697579 8:143991349-143991371 AGGGCTGGAAAGGGGGCTGTGGG - Exonic
1049702892 8:144023117-144023139 CTGGGGGGAGAGGGTCCTGAGGG - Intronic
1049762134 8:144336495-144336517 CAGGCGGGGGAGGAGGCTGGGGG + Intergenic
1049786717 8:144454405-144454427 CTGGCTGGAGTGGGGTGTGTGGG + Intronic
1049872321 8:144990409-144990431 CTGGAGGGAGGGGCAGCTGTGGG - Intergenic
1049938177 9:519232-519254 CTGTCGTGAGAGCGGGCTTTGGG - Intronic
1049941480 9:550196-550218 CTGGGGGGAGGGGAGGCGGTTGG - Intronic
1050700142 9:8329610-8329632 CTGGCGGAAGGGGCAGCTGTGGG - Intronic
1050852110 9:10300810-10300832 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1050973867 9:11912005-11912027 CTGGGGGAAGGGGCGGCTGTAGG - Intergenic
1051451691 9:17204783-17204805 CTGGGGGGAGGGGCGGCTGTGGG - Intronic
1051489621 9:17646970-17646992 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1051674529 9:19546285-19546307 CTGGCGGAAGGGGCGGTTGTAGG - Intronic
1051695764 9:19766888-19766910 CTGGGGGAAGGGGTGGCTGTGGG - Intronic
1051863340 9:21651448-21651470 CTGGGGGAAGAGGCGGCTATGGG - Intergenic
1052281169 9:26735166-26735188 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1052382289 9:27784801-27784823 CTGGCGAGAGGGGCGCCTGTGGG - Intergenic
1052506410 9:29359470-29359492 CTGGAGGAAGGGGTGGCTGTGGG + Intergenic
1052975306 9:34405832-34405854 CTGGGGGGTGAGGGAGATGTGGG - Intronic
1053056383 9:34995347-34995369 CTGGCAGTAGTGGGGGATGTGGG - Intronic
1054719829 9:68593742-68593764 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1055497164 9:76867200-76867222 CTGGCGGGGGCGGGGGCGGGGGG - Intronic
1055537827 9:77267762-77267784 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1055894859 9:81162947-81162969 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1056858972 9:90162074-90162096 CTGGCTGTAGAGGAGGGTGTCGG + Intergenic
1057415727 9:94860557-94860579 CTGGGTGGAGAGGGTGCTGGTGG + Intronic
1057460366 9:95255101-95255123 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1057673821 9:97121264-97121286 CTGGCGGGCGAGCGGGCTGCGGG - Intergenic
1058182571 9:101816061-101816083 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1058259862 9:102814912-102814934 CTGGGGGAAGAGGCGGCTGTGGG + Intergenic
1058393241 9:104520719-104520741 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1058676922 9:107407972-107407994 CTGTAGGGAGTGGGTGCTGTGGG - Intergenic
1059088902 9:111334837-111334859 CTGGGGGAAGAGGTGACTGTGGG + Intergenic
1060191920 9:121599136-121599158 CTAGCGGGAAGGGGAGCTGTAGG + Intronic
1060192149 9:121599929-121599951 CTTGCGGGAGAGGGGACTGTAGG - Intronic
1060218989 9:121754606-121754628 CTGGCAGAAGAGAGGGCTGTAGG - Intronic
1060222324 9:121771343-121771365 CTGGCGGGAGAGGGGAGAGTAGG - Intronic
1060462905 9:123875556-123875578 CAGGATGGAGAGGGGGCTGTGGG - Intronic
1060995885 9:127874758-127874780 CTGAGGGCAGAGGGGGCTGCTGG + Intronic
1061028956 9:128068271-128068293 CGGGCGGGAGCGGGGGCGGCGGG - Exonic
1061530447 9:131207892-131207914 CTGGCTGGAGAAGGAGCTGTTGG + Intronic
1061673326 9:132201523-132201545 CTGGTGGCAAAGGGGGATGTGGG + Intronic
1061924164 9:133797911-133797933 CTGTCAGGGGAGGGGCCTGTTGG - Intronic
1061980750 9:134102123-134102145 ATGGAGGCAAAGGGGGCTGTGGG + Intergenic
1062032245 9:134366920-134366942 CTGCTGGGAGAAGGGGCTGGTGG + Intronic
1062250696 9:135592232-135592254 GTGGGAGGAGAGGGGGCAGTGGG - Intergenic
1062285000 9:135768875-135768897 CTGGACGTAGAGGGGGCAGTTGG - Exonic
1062334265 9:136058148-136058170 CTGGCTGGCAAGGGGGCTGCTGG + Intronic
1062365574 9:136207119-136207141 CTGGCGGGAGAGGTGTCTGGTGG - Exonic
1062425669 9:136505089-136505111 CTGGTCGTACAGGGGGCTGTGGG + Exonic
1062444361 9:136587484-136587506 CTGCTGGAGGAGGGGGCTGTGGG + Intergenic
1203774550 EBV:65448-65470 CTACCTGGAGAGGGGGCAGTCGG + Intergenic
1186181270 X:6975798-6975820 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1186420311 X:9420330-9420352 TTGGTGGGAGAGGGGGATGAAGG - Intergenic
1186455590 X:9707768-9707790 CCGACTGGAGAGGGGGCTGAGGG - Intronic
1186773261 X:12838952-12838974 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1186832561 X:13404797-13404819 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1187495574 X:19792773-19792795 CTGGCGGGGGCGGGGGGTGGGGG + Intronic
1187784371 X:22867226-22867248 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1188084179 X:25882883-25882905 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1188296412 X:28455729-28455751 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1189721810 X:43927387-43927409 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1190341407 X:49299605-49299627 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1190877917 X:54472650-54472672 CTGGCTGGGCAGGGGGCTGTGGG + Intronic
1190943921 X:55072664-55072686 CTGGGGGAAGAGGTGGCTGTGGG - Intergenic
1190963687 X:55277718-55277740 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1191024322 X:55896939-55896961 CTGGGGGAAGGGGCGGCTGTAGG + Intergenic
1191138962 X:57095189-57095211 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1191153086 X:57241985-57242007 CTGGGGGAAGGGGAGGCTGTGGG + Intergenic
1191168483 X:57417825-57417847 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1191606303 X:63066179-63066201 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1191676679 X:63798296-63798318 CTGGGGGCAAAGGCGGCTGTGGG + Intergenic
1191724187 X:64261444-64261466 TTGCTGGGAGAGGGGGCAGTGGG + Intergenic
1191802751 X:65099257-65099279 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1192030752 X:67509733-67509755 CTGGCGGGAGGGGTGGCTGTGGG + Intergenic
1192227997 X:69242592-69242614 CTGGGGGTAGGGGGAGCTGTAGG - Intergenic
1192290591 X:69790316-69790338 ATGTCGGGAGAGGGGGCAGAGGG + Intronic
1192508933 X:71710613-71710635 CTGGCGGGGGAGGGGGGCGGGGG - Intergenic
1192509484 X:71713451-71713473 CCGGCTGCAGAAGGGGCTGTTGG + Intergenic
1192511261 X:71721692-71721714 CTGGCTGCAGAAGGGGCTGCTGG - Intergenic
1192511800 X:71724593-71724615 CTGGCGGGGGAGGGGGGCGGGGG + Intergenic
1192514897 X:71756912-71756934 CTGGCGGGGGAGGGGGGCGGGGG - Intergenic
1192515436 X:71759861-71759883 CTGGCTGCAGAAGGGGCTGCTGG + Intergenic
1192517213 X:71768102-71768124 CCGGCTGCAGAAGGGGCTGTTGG - Intergenic
1192517764 X:71770940-71770962 CTGGCGGGGGAGGGGGGCGGGGG + Intergenic
1192523845 X:71824604-71824626 CCGGCTGCAGAAGGGGCTGTTGG - Intergenic
1192528643 X:71868614-71868636 CTGGCTGCAGAAGGGGCTGTTGG + Intergenic
1192530873 X:71883451-71883473 CTGTCGGGGGTGGGGGCTGGGGG + Intergenic
1192587097 X:72327817-72327839 CTGGAGACAGAGGGGGCTGGTGG + Intergenic
1192637133 X:72830723-72830745 CTGGGGGAAGGGGCGGCTGTGGG - Intronic
1192644581 X:72890091-72890113 CTGGGGGAAGGGGCGGCTGTGGG + Intronic
1192662190 X:73052918-73052940 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1192703117 X:73497634-73497656 CTGGGGGAAGAGGTGGCTGTGGG - Intergenic
1193010692 X:76671579-76671601 CTGCAGGAAGAGGTGGCTGTGGG + Intergenic
1193060103 X:77197051-77197073 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1193075235 X:77348031-77348053 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1193081531 X:77411634-77411656 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1193341262 X:80352259-80352281 CTGGAGGAAGCGGGGGCTGTGGG - Intronic
1193355941 X:80520790-80520812 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1193361649 X:80586469-80586491 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1193525242 X:82580929-82580951 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1193685485 X:84572027-84572049 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1193830054 X:86279088-86279110 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1193897321 X:87129151-87129173 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1194158588 X:90422969-90422991 CTGGGGGAAGAGGTGGCTGTGGG + Intergenic
1194282159 X:91966492-91966514 CTGTCGGGGGTGGGGGCTGGGGG + Intronic
1194419982 X:93661254-93661276 CTGGGGGAAGGGGCGGCTGTAGG + Intergenic
1194559599 X:95403944-95403966 CTGGGGGAAGGGGCGGCTGTAGG + Intergenic
1194576305 X:95618514-95618536 CTGGGGGAAGAAGCGGCTGTGGG - Intergenic
1194798340 X:98240433-98240455 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1194954366 X:100162191-100162213 CTGGGGGAAGGGGAGGCTGTGGG - Intergenic
1195232963 X:102869776-102869798 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1195826229 X:109003890-109003912 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1195882197 X:109603931-109603953 CTGGGGGAAGGGGCGGCTGTGGG + Intergenic
1195932015 X:110087912-110087934 CTGGATGGAGAGAGGACTGTAGG + Intronic
1195985623 X:110626862-110626884 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1196281122 X:113825110-113825132 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1197051245 X:122061580-122061602 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1197071228 X:122300179-122300201 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1197157273 X:123283792-123283814 CTGGAGGAAGGGGTGGCTGTGGG + Intronic
1197191141 X:123648860-123648882 CTTGGGGAAGAGGCGGCTGTGGG + Intronic
1197350079 X:125372348-125372370 CTGGGGGAAGGGGCGGCTGTGGG - Intergenic
1197614251 X:128674618-128674640 CTGGGGGAAGGGGTGGCTGTGGG - Intergenic
1197711773 X:129676727-129676749 GTGGAGGGGGAGGGGGATGTTGG - Intergenic
1198030585 X:132750114-132750136 CTGGCTGGGGATGAGGCTGTTGG - Intronic
1198295340 X:135282085-135282107 CTGGGGGAAGAGGTGGCTGTGGG - Intronic
1198379497 X:136070582-136070604 CTAAGGGGAGAGTGGGCTGTAGG + Intergenic
1198519049 X:137433925-137433947 CTGGGGGAAGGGGTGGCTGTGGG + Intergenic
1198519858 X:137441793-137441815 GTGGTGGGAGACGGAGCTGTAGG - Intergenic
1199505283 X:148554454-148554476 CTGGAGGGAGACAGGGCTGGAGG + Intronic
1200108127 X:153725527-153725549 GTGCCGGGAGACGGGGCTGCTGG + Exonic
1200145803 X:153926160-153926182 GCGGCGGGAGCGGGGGCTGCAGG - Exonic
1200504904 Y:3999937-3999959 CTGGGGGAAGAGGTGGCTGTGGG + Intergenic
1200549427 Y:4559515-4559537 CTGGAGGAAGTGGTGGCTGTGGG + Intergenic
1200599752 Y:5191151-5191173 CTGTCGGGGGTGGGGGCTGGGGG + Intronic
1201376782 Y:13331042-13331064 CTGGGGGAAGGGGTGGCTGTGGG + Intronic
1202202464 Y:22367526-22367548 GTGGCGGGAGAGGCGCCTGTGGG - Intronic