ID: 1143479168

View in Genome Browser
Species Human (GRCh38)
Location 17:7218794-7218816
Sequence TCCTTGTGGAGGGGAGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143479168_1143479175 -2 Left 1143479168 17:7218794-7218816 CCCAGACCTCCCCTCCACAAGGA 0: 1
1: 0
2: 3
3: 31
4: 263
Right 1143479175 17:7218815-7218837 GAGCCCTGTTTTTCACCTCTTGG 0: 1
1: 0
2: 0
3: 13
4: 146
1143479168_1143479179 6 Left 1143479168 17:7218794-7218816 CCCAGACCTCCCCTCCACAAGGA 0: 1
1: 0
2: 3
3: 31
4: 263
Right 1143479179 17:7218823-7218845 TTTTTCACCTCTTGGTCTCTGGG 0: 1
1: 0
2: 1
3: 75
4: 1041
1143479168_1143479178 5 Left 1143479168 17:7218794-7218816 CCCAGACCTCCCCTCCACAAGGA 0: 1
1: 0
2: 3
3: 31
4: 263
Right 1143479178 17:7218822-7218844 GTTTTTCACCTCTTGGTCTCTGG 0: 1
1: 0
2: 0
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143479168 Original CRISPR TCCTTGTGGAGGGGAGGTCT GGG (reversed) Intronic