ID: 1143481201

View in Genome Browser
Species Human (GRCh38)
Location 17:7228169-7228191
Sequence CTAGAGAAGGTGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 554}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143481201 Original CRISPR CTAGAGAAGGTGAGGGTGGA AGG Intronic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
900907523 1:5571372-5571394 TTAGACAAGTTGAGGCTGGATGG + Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901554990 1:10024622-10024644 CTTGAGAAGGTGAGAGAGAAAGG + Intergenic
901849514 1:12006711-12006733 CTCGGGAAGGTGGGGGCGGAGGG + Intronic
902293733 1:15451923-15451945 CTAGAGGAGGTCAGCGTGCAAGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903811336 1:26036530-26036552 CTCCAGAGGGTGAGGGTGGTGGG + Intergenic
904544296 1:31256322-31256344 CAAGAAAAGATGAGGGTGGGTGG + Intergenic
904669709 1:32154487-32154509 CCAGAGTAGGGGAGGGTGAAGGG + Intronic
905014318 1:34766757-34766779 CTAGAGTAGGTGAGGGGTGAAGG - Intronic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905360328 1:37414814-37414836 CCAGAGAAGGTGGGGGAGGGGGG + Intergenic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
906661982 1:47589553-47589575 CTGGAGACGGTGAGGAAGGAGGG - Intergenic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
907823358 1:57991892-57991914 CTAGAGCTGCTGATGGTGGAAGG + Intronic
907919722 1:58901254-58901276 CTGGAGAAGGTGGGGGTTGGGGG + Intergenic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
911786529 1:101956471-101956493 GAAGAGAAGGTGAGGGTAGATGG - Intronic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912823703 1:112886975-112886997 AGAGAGATGGTGAGGGTGGTGGG - Intergenic
914879075 1:151533918-151533940 AGTGAGAAGGTGAGGGTTGAGGG - Intronic
915129884 1:153688827-153688849 CTAGAGACGCTCAGGGTTGAGGG - Intronic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
917478008 1:175385384-175385406 CTTGAGAATGTGGGGGTGGGTGG + Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919583838 1:199410767-199410789 CAAGGGAAGGTGAGGGAGCAGGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920446646 1:206023142-206023164 CTAGAGAAGATGGGGTGGGAGGG + Intronic
920491128 1:206416227-206416249 GCAGAGGAGGCGAGGGTGGAGGG - Intronic
921909611 1:220532900-220532922 CTAGAGAGGCTGAGGTGGGAGGG + Intronic
922273684 1:224057137-224057159 TTACACAAGGTGTGGGTGGAGGG + Intergenic
922273723 1:224057482-224057504 TTACACAAGGTGTGGGTGGAGGG - Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923063412 1:230497412-230497434 CTAGAGAGCGTGAGGGAGAAAGG + Intergenic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
923583559 1:235242847-235242869 CTTGAGTAGGTGAGGGGGAAGGG - Intronic
924387543 1:243513126-243513148 TTAGGGAAGGTGGGGGTGGAAGG + Intronic
1063921186 10:10934710-10934732 TTCGAGAGGGTGAGGGTTGAGGG + Intergenic
1064346749 10:14539839-14539861 GTAGAGGAAGTGAGGGTGCAGGG - Intronic
1065260626 10:23919879-23919901 CTGGAGAAGGTCAGGAAGGAAGG - Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1067056203 10:43053100-43053122 CTAGAGGAGAGGAAGGTGGAGGG - Intergenic
1069366435 10:67699086-67699108 CTTGAAAAGGTGAGGGAAGAAGG - Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069756597 10:70777506-70777528 CTAGGGCAGGTGAGGTTGGGGGG - Intronic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1071454214 10:85831274-85831296 CTTGAGTACATGAGGGTGGAGGG + Intronic
1071548556 10:86547740-86547762 CTAGGGAGGCTGAGGGTGGCAGG + Intergenic
1072633967 10:97165549-97165571 CTAGAGTAGCTGAGGGGTGAAGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1074211521 10:111339755-111339777 GTAAAGAAGGTGGGGGTGGGGGG + Intergenic
1074265910 10:111903076-111903098 TTAGAGAAGGCAAGGGTGAAAGG + Intergenic
1074339965 10:112618867-112618889 TAAGAGGAGGTGAGGTTGGAAGG + Intronic
1075219990 10:120576467-120576489 CCAGAGAAGATGAGGAAGGAGGG - Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076887334 10:133268734-133268756 CCTGAGCAGGTGAGGGTGGTGGG - Exonic
1077196947 11:1285928-1285950 CTAGGGCAGGTGCGGGAGGAGGG - Intronic
1078497010 11:11827619-11827641 CTTGAGAGGCTGAGGTTGGAGGG - Intergenic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079330232 11:19527034-19527056 ATAGAGATGGTGGGGGTGGGAGG - Intronic
1079334521 11:19559600-19559622 CTAGGGTGGCTGAGGGTGGATGG + Intronic
1079451692 11:20604206-20604228 CTAGCGGGGGGGAGGGTGGAAGG + Intronic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1080218334 11:29871317-29871339 CTAGAGAAGCTGAGGTGGGGAGG - Intergenic
1080551240 11:33375881-33375903 CTAGAGAAGGGAAGGTTGGCGGG - Intergenic
1081504884 11:43705868-43705890 CTAGAGAGGCTGAGGTGGGAAGG - Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083921705 11:65784543-65784565 CGAGAGAATGTGATGGTGGCAGG - Intergenic
1084545294 11:69812366-69812388 CCAGAGCAGGGAAGGGTGGAAGG + Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1086162273 11:83735131-83735153 TTAGAGAGGGTTAGGATGGAAGG + Intronic
1086421180 11:86638978-86639000 CTAGAGAATGTTAGATTGGAAGG + Intronic
1086758307 11:90593263-90593285 CTAGAGAAGGTGAGTGGATAGGG + Intergenic
1086789175 11:91014137-91014159 CAAGAGGTGGTGAGGGTGTAAGG + Intergenic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087838565 11:102898948-102898970 CTTGGGAAGGTGAGGAGGGAGGG + Intergenic
1088965578 11:114717748-114717770 GTCGAGAAGATGAGGGAGGAGGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089654302 11:119935735-119935757 CAAGGGGAGGTGAGGGTGGGTGG - Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1090906711 11:131083234-131083256 CTAGAAAAAGTGAGGGTAAATGG - Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091266185 11:134272941-134272963 CTTGAGAAGGTAAGAGAGGAGGG - Intergenic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092040251 12:5378045-5378067 CTAGAGAAGGTGGAGGTGGGTGG - Intergenic
1092380937 12:7996571-7996593 CCAGAGAATGTGACGGGGGAAGG - Intergenic
1092655472 12:10679766-10679788 ATAGATAAGGTGAGGGTTAAGGG - Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094084384 12:26573750-26573772 CGAAAGAAGGTCAGTGTGGATGG + Intronic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1094525418 12:31227774-31227796 CCAGGGAGGGTGAGAGTGGAGGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095905066 12:47369154-47369176 CCTGAGAAGGTGAGGGGGGCTGG + Intergenic
1096174330 12:49502557-49502579 CTAGGGAGGCTGAGGGTGGGAGG - Intronic
1096239994 12:49954724-49954746 CTAGAGAAGGGGAGGGCAGGGGG - Intronic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097964038 12:65560179-65560201 CTAGAAAGGGTGAGAGTGGGTGG + Intergenic
1098130395 12:67344336-67344358 CTTGGGAGGTTGAGGGTGGAAGG - Intergenic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099328002 12:81244262-81244284 CTAGAGAAAGCCAGAGTGGAGGG - Intronic
1099729603 12:86484043-86484065 CTAGAGAAGGTGTGAGTAAAGGG + Intronic
1100436606 12:94576921-94576943 CTAGAGAAGGCGGGACTGGAAGG - Intronic
1101059835 12:100959274-100959296 CTTGAGAAGGTGAGGTGAGAGGG - Intronic
1101396600 12:104354171-104354193 TTAGAAGAGGTGGGGGTGGAGGG + Intergenic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1101814253 12:108133749-108133771 TTACAGAAGGTGAGGGAGGCGGG - Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103701236 12:122849722-122849744 CTAGAGACAGAGAGGGTGGTTGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104388199 12:128369018-128369040 CCTGAGAAGGTGTGAGTGGATGG + Intronic
1104996482 12:132660935-132660957 TCAGAGCAGGTGAGGGTGGAGGG + Intronic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1105989699 13:25606703-25606725 ATAGAAAATGTGTGGGTGGATGG - Intronic
1107062294 13:36172741-36172763 CTAGCGCAGGTGAGGGAGGAAGG + Intronic
1107159485 13:37209457-37209479 CTAAATAAGGTGGGGGTGGTGGG - Intergenic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110657627 13:78019017-78019039 GTAGACAAGGTCAGGGTGGGAGG + Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1113667950 13:112153991-112154013 CATGAGCAGGTCAGGGTGGATGG - Intergenic
1113740928 13:112711908-112711930 ATAGATAAGGAGCGGGTGGAGGG + Intronic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1118745657 14:68771205-68771227 ACAGAGAAGGTGATGGTGGGAGG - Intergenic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1118905273 14:70018960-70018982 TTAGAGAAGGTAAGGCGGGACGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121515684 14:94548410-94548432 CTAGAGAAGGACAGGGCAGAAGG + Intergenic
1121825840 14:97008717-97008739 CCAGAGAAGGCAAGGGTGGCTGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122411520 14:101528377-101528399 TCAGAGAAGGTAAGGGGGGACGG + Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123794557 15:23758391-23758413 TGAGAGAAGATGAGGGTGAAGGG + Intergenic
1125243114 15:37599781-37599803 CTATAGAAGATGATGGTGAAAGG - Intergenic
1125328992 15:38564490-38564512 CGAGGGAAGTTGAGGGCGGAGGG - Intronic
1125364939 15:38903570-38903592 ATAGAGCAGGGGAGGTTGGAAGG - Intergenic
1126600134 15:50419644-50419666 CTAGAGAGGCTGAGGTGGGACGG + Intergenic
1126793533 15:52242008-52242030 CTAGAGGAAGGGAGGGTGTACGG - Intronic
1126960956 15:53993532-53993554 TGAGAGAAGGTGAGGATGGGAGG + Intergenic
1127153485 15:56104210-56104232 CTAGGGATGGTGGGGGTAGAAGG - Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127974899 15:63990064-63990086 CCACAGAGGGTGAGGGTGGGTGG - Intronic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128858608 15:71044676-71044698 CTGGAGAAGGTAAGGTGGGAGGG + Intronic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129242059 15:74257666-74257688 GGAGAGAAGGTGAGGCTTGAGGG - Intronic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129582017 15:76821512-76821534 CTAGAGAGGCTGAGGTTGGGGGG + Intronic
1130744497 15:86636259-86636281 CTAAAGAAGGTGAGGTTTCATGG - Intronic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132007052 15:98236827-98236849 CTAAAAGAGGTAAGGGTGGATGG - Intergenic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1134197174 16:12168255-12168277 TTTGAGCAGATGAGGGTGGAGGG + Intronic
1134885455 16:17786914-17786936 GCAGTGAGGGTGAGGGTGGAGGG - Intergenic
1135290682 16:21235333-21235355 CTAGAGAAGCTGAGTATGGCTGG + Intronic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1135609101 16:23849315-23849337 ATAGTGTAGGTGAAGGTGGAGGG + Intronic
1135643493 16:24141624-24141646 CTAGAAAAGATGAGTTTGGAAGG + Intronic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1136452783 16:30363423-30363445 ATAGAGAATGTGAGTGGGGATGG - Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1137550454 16:49434005-49434027 CTAGAGACGATGAAAGTGGAAGG + Intergenic
1137811854 16:51359935-51359957 CTACAGAAGGACAGGGTGGGAGG - Intergenic
1138083135 16:54110745-54110767 GGAGAGAAGGCGGGGGTGGAGGG + Intronic
1138303060 16:55948720-55948742 CTAGGGATGGTGATGGTGGCTGG + Intronic
1139324187 16:66139321-66139343 CTAGGGAGGCTGAGGGGGGAGGG - Intergenic
1139578553 16:67857861-67857883 GGACAGAAGGTGTGGGTGGAGGG + Intronic
1139665043 16:68449080-68449102 CCAGCAAAGGTGAGGGAGGACGG + Intergenic
1139758644 16:69166247-69166269 TTTGTGAAGGTGGGGGTGGAAGG + Intronic
1140058480 16:71546489-71546511 CTTGAGAAGGTGGGAGAGGATGG - Intronic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1141826020 16:86480836-86480858 CTCGAGAAGGCCAGGGTGCAGGG + Intergenic
1142031643 16:87841433-87841455 CTACAGGAGGTCAGGATGGAGGG + Intronic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143071464 17:4298215-4298237 CTTGAGAGGCTGAGGGGGGAAGG + Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143310537 17:5984916-5984938 TTAGAGGAGATGAGGTTGGAAGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143674535 17:8422298-8422320 CAAAAAAAGGTGGGGGTGGAGGG - Intronic
1144325096 17:14171659-14171681 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1144473970 17:15568538-15568560 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1146280268 17:31540130-31540152 CTAGAGAGGGGGATAGTGGAGGG + Intergenic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1146970584 17:37068497-37068519 CTAGAGCAGCTGGGGATGGAAGG + Intergenic
1146975425 17:37107416-37107438 CTAGAGAAGGCTTGGGAGGAAGG + Intronic
1147111080 17:38262091-38262113 CTGGAAAAGGTGAGTGTTGAAGG - Intergenic
1147218943 17:38917012-38917034 CTAGAGTGGGAGAGGGTGGGAGG + Intronic
1147250994 17:39152219-39152241 CTAGCAGACGTGAGGGTGGAGGG + Intronic
1147621919 17:41873797-41873819 CCAGAAAAGGTGAGCATGGAGGG - Exonic
1147720537 17:42536941-42536963 AAAGAGAAGGTGGGGGAGGAAGG - Intronic
1147871781 17:43592594-43592616 CTAGAGATGGGGAGAGTGGCTGG - Intergenic
1147921442 17:43919536-43919558 CTAGAGATGGTGAAGGTTGGGGG - Intergenic
1148418430 17:47526350-47526372 CTGGAAAAGGTGAGTGTTGAAGG + Intronic
1148575582 17:48708411-48708433 GGAGAGAAGGTGCGGGTGGTAGG + Intergenic
1149200704 17:54182876-54182898 AGTGAGAAAGTGAGGGTGGAGGG - Intergenic
1149498205 17:57132445-57132467 CTGGAGGGGGTGAGGGTGGGCGG + Intergenic
1149498262 17:57132589-57132611 CTGGAGGGGGTGAGGGTGGGTGG + Intergenic
1150202277 17:63369920-63369942 GTAGGGAAGGTAAGGATGGAGGG - Intronic
1150644436 17:66969234-66969256 CTAGAGTTGGTGTGGGTGGCAGG - Intronic
1151116592 17:71742554-71742576 CTAGAAAGGGAGAGGGTGGGAGG + Intergenic
1152107548 17:78339924-78339946 GTAGAGACGGTGGGGGTGGGGGG - Intergenic
1152288359 17:79425100-79425122 CAAGAGGAGGTGAGAGAGGAGGG - Intronic
1152322752 17:79617364-79617386 CGAGGGAAGGCGAGGATGGAAGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153130475 18:1850645-1850667 ATAAAGACAGTGAGGGTGGAAGG + Intergenic
1153283753 18:3438366-3438388 AGAGAGAAGGTGAGGGAGGGAGG + Intronic
1153382235 18:4453937-4453959 CTAGAGAAGGGGAGGATGTGCGG - Intronic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153894011 18:9542951-9542973 CTGGTGTAGGTGAGGGTGGGAGG - Intergenic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1156063637 18:33114125-33114147 GTAGCAAAGATGAGGGTGGAAGG - Intronic
1156491860 18:37501094-37501116 TGAGAGAAGGTGGGGGTGGCCGG + Intronic
1156513341 18:37659983-37660005 GAAGAGAAGGTGGGGGTGGGGGG + Intergenic
1157461762 18:47903357-47903379 CTAGAGAAAGAGGGGGTGGGGGG + Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1159732850 18:72053322-72053344 CAAGGGAGGGTGAGGGTGGTGGG + Intergenic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160324480 18:77930734-77930756 CTACAAAAAGTGTGGGTGGAGGG - Intergenic
1161077013 19:2290725-2290747 CTAGAGACGCTGCGCGTGGACGG - Exonic
1161908940 19:7178258-7178280 CTAGATAACATGAGGGTGGGGGG + Intronic
1162127418 19:8506914-8506936 ATAGAGAAGGTGAGGCTAGGAGG - Intergenic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162878980 19:13643260-13643282 CTAGAGAAGGCAAGGCTGTAGGG - Intergenic
1163284607 19:16338577-16338599 CTCGAGAGGATGCGGGTGGAGGG - Intergenic
1163816473 19:19467979-19468001 CTACATAAATTGAGGGTGGAGGG + Intronic
1164402634 19:27912129-27912151 CTAGAGATGGGGAGGCAGGAAGG + Intergenic
1165147253 19:33738931-33738953 CTAGAGAGGGAGATGGTGGGTGG + Intronic
1165286568 19:34847615-34847637 CTAGAGGAGCTGAGAGTGGCTGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1167645359 19:50702679-50702701 TGAGAGGAGGGGAGGGTGGAGGG + Intronic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168514819 19:57002499-57002521 CTAGGGGAGGACAGGGTGGACGG - Intergenic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925903869 2:8527592-8527614 CGAGAGGAGGTGAAGGAGGAAGG - Intergenic
926425903 2:12738480-12738502 GCAGAGAAGGTGAGGAGGGATGG - Intronic
926625726 2:15088099-15088121 GTAGAGAAGGAGAGGCTGGGTGG + Intergenic
926697346 2:15780107-15780129 TGAGAGTTGGTGAGGGTGGAGGG + Intergenic
926756699 2:16242213-16242235 GTAGAGAAGATGAGTGTGCAAGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927295326 2:21446559-21446581 CTCGAGAAGGTCAGTGTGGCTGG - Intergenic
927884367 2:26709603-26709625 CGAGGGAAGGGGAGGGTGGTGGG + Intronic
928367818 2:30716222-30716244 ACAGAGGAGGGGAGGGTGGACGG - Intergenic
928434346 2:31244442-31244464 CTTGAACAGGTGAGTGTGGAGGG + Exonic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
929245667 2:39699697-39699719 CTTGAGAAGCTGAGGTGGGAGGG - Intronic
929814623 2:45221052-45221074 TTAGAGGATGTGGGGGTGGATGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
930639189 2:53838027-53838049 CAAGAAAAGGTGAAGGTGTAAGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
934508198 2:94913326-94913348 CTACAGAGGGTGAGTGTGAATGG - Intergenic
934692484 2:96372312-96372334 CTGGAGGAGGTGCGCGTGGATGG + Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
936503100 2:113082024-113082046 GTGGAGCTGGTGAGGGTGGATGG + Intergenic
936912034 2:117603434-117603456 ATAGAGCAGGTGCGGATGGAGGG - Intergenic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
938293739 2:130163922-130163944 CTGGAGAAGGTGGGGGAGTAGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939607028 2:144265727-144265749 TTAGAGAAGGGGTGGGAGGAGGG - Intronic
940697653 2:156999846-156999868 CTTGAGAAGGTGAGAATAGATGG + Intergenic
940720082 2:157272522-157272544 CTAGAGAGGGTAAGGAAGGAGGG - Intronic
941011782 2:160308285-160308307 CTCAGGAAGCTGAGGGTGGAAGG + Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
942338301 2:174915240-174915262 CAAGAGAAGGTGGTGGTGGTGGG - Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943266490 2:185738841-185738863 CTAGAGAAGGAGAGCGGGGCGGG + Exonic
943536260 2:189154538-189154560 CTAGGGAGGGTGAGGGAAGAGGG - Intronic
943713404 2:191123461-191123483 TGAGAGAAGGTCAGGCTGGATGG - Intronic
944442450 2:199756336-199756358 CAGGAGAAGGTGTGGGTGAAAGG + Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
944911826 2:204317974-204317996 CTAGAGCAGGTGAAGGATGAAGG - Intergenic
944927428 2:204479493-204479515 TTAGTGAAGGTGAGGATGGGGGG - Intergenic
945690617 2:213030487-213030509 CTAAAGTAGTTGAGGGTGGGGGG + Intronic
946028775 2:216689099-216689121 CGAGAGAGGGTGTGGTTGGATGG - Intronic
946142423 2:217703108-217703130 CTAGGAAAGGTGAGAGTGGCTGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946329331 2:219000788-219000810 CTAGAGCGGGTGGTGGTGGAGGG + Intergenic
946395356 2:219441586-219441608 CGGGAGGAGGTGAGGGTGGGAGG + Intronic
946462501 2:219881645-219881667 ATAGAGGAGGTGAGGTGGGATGG - Intergenic
946946445 2:224827323-224827345 TTAGAGATGGTTAGAGTGGAAGG + Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948494119 2:238334893-238334915 CTGGAGAAGGTGTGGGGTGAAGG - Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169090680 20:2859817-2859839 CCAGAGCAGGTGGTGGTGGAGGG - Intronic
1169106638 20:3001803-3001825 CTTGAGTAGGTGAGGGCAGATGG + Intronic
1169132594 20:3173726-3173748 CTAGAGAGGGTGAGGCTGAGGGG - Intergenic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172043635 20:32063610-32063632 TTAGAGTAGGTGAGGATGGGAGG - Intronic
1173331246 20:42077964-42077986 CCAGACAGGATGAGGGTGGAGGG - Exonic
1173373534 20:42461427-42461449 CTGGAGAGGGTGAGGTGGGAGGG + Intronic
1173524270 20:43720062-43720084 CCAGATCAGGTGAGGCTGGATGG - Intergenic
1173927567 20:46792199-46792221 CCAGATAAGGTGAGGCGGGAGGG - Intergenic
1174033721 20:47652297-47652319 TTAAAGGAGGTGGGGGTGGAGGG - Intronic
1174216691 20:48921588-48921610 AGACAGAAGGCGAGGGTGGAGGG - Intergenic
1174405987 20:50303779-50303801 TCAGAGGAGGGGAGGGTGGATGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1174736954 20:52973469-52973491 CCAGAGAAGGCGAGAGAGGACGG - Intronic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175419392 20:58821889-58821911 GGAGAGGAGGTGAGGGAGGAGGG - Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176623784 21:9074846-9074868 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177419273 21:20835052-20835074 CTTGAGTACTTGAGGGTGGAAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1179205970 21:39278975-39278997 CTAGGGAGGCTGAGGCTGGAGGG - Intronic
1179477858 21:41659465-41659487 GAAGAGAGGGTGAGGGTGAACGG + Intergenic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1180831934 22:18910981-18911003 CTGGAGAAGGCGGGGGTGGCTGG + Exonic
1180990753 22:19934271-19934293 CTAGGGAGGCTGAGGCTGGAGGG + Intronic
1181067911 22:20315361-20315383 CTGGAGAAGGCGGGGGTGGCTGG - Exonic
1181536820 22:23550603-23550625 CGAGAGAATGGGAGGATGGAAGG - Intergenic
1182160241 22:28114313-28114335 CTTGAGAAGGAGAGGGTTCAGGG - Intronic
1182198342 22:28542350-28542372 CCACAGAAGGTGAGGAAGGAGGG + Intronic
1182232143 22:28846401-28846423 CCAGGGAAGGTGGGGCTGGATGG + Intergenic
1182411438 22:30190213-30190235 GTAGAGAAAGAGAGGGTTGAGGG - Intergenic
1182620578 22:31616424-31616446 TTAGAGCAGGTGGGGGTGGAGGG + Intronic
1183360664 22:37381535-37381557 CTAGAGAAGGTGGGGGTCAGGGG - Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185295378 22:50050555-50050577 CTAGGCAAGGTGGGGGAGGAGGG - Intronic
1203282012 22_KI270734v1_random:136252-136274 CTGGAGAAGGCGGGGGTGGCTGG + Intergenic
949564242 3:5230325-5230347 CTAGAGAAAGTGAGGCTGAGAGG + Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950032146 3:9860326-9860348 CTAAAGAAGGTGGGGGCGGTGGG + Intergenic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951063102 3:18233670-18233692 GTAGAGAAGCTAAGGGTAGAGGG + Intronic
951350924 3:21605993-21606015 CAAGAGAAAGTCAGAGTGGAAGG - Intronic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953156543 3:40380323-40380345 CTAGAGCAGGTGCAAGTGGATGG + Intergenic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953381769 3:42477619-42477641 CTAGGGGAGGTGAATGTGGAGGG - Intergenic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955861215 3:63332563-63332585 AGAGAGAAGGTATGGGTGGATGG + Intronic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
956825975 3:72997093-72997115 CCGGAGAAGGTGAGGGGGAATGG - Intronic
958677707 3:97288232-97288254 CTACAGAGGGTGAGGAAGGAAGG - Intronic
959715878 3:109431980-109432002 CTAGAGAGGATCACGGTGGACGG - Intergenic
960334431 3:116399082-116399104 CAAGAGAAGGTAGAGGTGGAAGG + Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
961155701 3:124677838-124677860 CTTGAGAAGGGCACGGTGGATGG - Intronic
961222693 3:125212686-125212708 CAGGAGCAGGTGAGGGCGGAAGG - Intronic
961344222 3:126251877-126251899 CGAGAGAAGGGGAGGTTGGGAGG - Intergenic
961485995 3:127216924-127216946 CTAGAGAAAGTGAGGTGGGAAGG - Intergenic
961720767 3:128894469-128894491 CTAGAAAAAGTGTGGATGGAAGG + Intronic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962758107 3:138483732-138483754 ATAGTGGGGGTGAGGGTGGAGGG - Intergenic
962805985 3:138928270-138928292 CTTAAGAAGGTGTGTGTGGAAGG + Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
965368158 3:167824936-167824958 CTAGAGGTGTTGGGGGTGGAAGG + Intronic
966779583 3:183572567-183572589 CAAGAGAAATTGAGGGTGGCAGG + Intergenic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967136168 3:186514721-186514743 CCACAGAAGGGGTGGGTGGAAGG - Intergenic
967148549 3:186627179-186627201 TCAGGGAAGGTGAGGGTGGGAGG - Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968091615 3:195901554-195901576 CTAAGGAAGGTGAGAGGGGAGGG - Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
969481315 4:7448539-7448561 GTAGAGAAAGGGAGGGAGGAAGG - Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
971522007 4:27565438-27565460 CTTGAGTAGGTGAGGGAGAATGG - Intergenic
971611288 4:28730359-28730381 CTAGGGAGGGTGTAGGTGGAAGG - Intergenic
972293615 4:37715321-37715343 CTAGAGCTGGGGAGGATGGATGG - Intergenic
972298954 4:37767152-37767174 CCAAAGAAGCTGAGGGTGGCAGG - Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
973321296 4:48812948-48812970 CTTGAGTAGGTGAGAGAGGATGG + Intronic
973952832 4:56035023-56035045 CTAAAGAAAGTGAGGGTGATGGG - Intergenic
975735941 4:77381156-77381178 CTAGATCAGGTGATGGTGTATGG - Intronic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
981658478 4:147139055-147139077 CTACACAAGTTGAGGGTGGCTGG + Intergenic
981695004 4:147551139-147551161 CCAGAGAAGGTGAGAGGGGGAGG + Intergenic
981872950 4:149508248-149508270 CTAGAGAAGCTGAGAGAAGAGGG + Intergenic
982224195 4:153151344-153151366 CTTGAGAAGGTCAAGGTGGGCGG + Intergenic
982754047 4:159197784-159197806 CTAGAGGAGGTGTGGGAGAAAGG - Intronic
984556364 4:181218731-181218753 CCTGAGAAGGTGAGGTGGGATGG + Intergenic
984605946 4:181786472-181786494 CTAAAGAAGGTGAGGGATGAGGG + Intergenic
984679268 4:182588420-182588442 ATAGATAAGGACAGGGTGGAAGG - Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986501130 5:8401032-8401054 CTTGAGCAGGTGAAGATGGATGG + Intergenic
986746379 5:10748406-10748428 CTAGGGAAGGTCAGGGTTGTCGG + Intronic
989035050 5:37162118-37162140 CTAGTGAAGGTGAGCTAGGAAGG - Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
990989091 5:61667956-61667978 GTTGAGAAGTTGTGGGTGGATGG + Intronic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991195824 5:63930953-63930975 CTAGAGAGGCTGAGGTTGGGAGG - Intergenic
991275595 5:64842842-64842864 TTTGAGAGGGTGAGGGTGGGCGG - Intronic
991615307 5:68490965-68490987 ATACAGAAGGTGGGAGTGGAAGG + Intergenic
991978705 5:72209768-72209790 CTAGAGGATGTGAGCGTGTAAGG + Intergenic
992414045 5:76535885-76535907 CTAGAGGAGGTGAGTAGGGATGG + Intronic
992810698 5:80385520-80385542 CTAGAGAAAGTGGGGGAAGATGG + Intergenic
993398034 5:87414927-87414949 CTAATGGAGGTGTGGGTGGAGGG - Intergenic
994222930 5:97217337-97217359 CTAGAGAGGCTGAGGTGGGAGGG + Intergenic
995217746 5:109614587-109614609 CTAGAGAAGGAGAGGGGAAATGG + Intergenic
995442624 5:112208573-112208595 CTAGAGGAGGAGAGGGGGCAAGG + Intronic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
998119289 5:139562221-139562243 CTAGGGCAGGTGTGGGAGGAGGG - Intronic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
999313707 5:150570364-150570386 TTAGAGAACTGGAGGGTGGAGGG - Intergenic
999652443 5:153780780-153780802 GAAGAGATGGTGAGTGTGGAGGG - Intronic
1000079421 5:157830915-157830937 CTACTGGAGGTGAGGGTGGAGGG + Intronic
1000279785 5:159772850-159772872 CGAGTGAGGGTGTGGGTGGATGG + Intergenic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000756126 5:165162336-165162358 CTATAGAAGGTGGGGGAGGTGGG - Intergenic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1000957694 5:167562024-167562046 AAAGAGATGGTGAGCGTGGAGGG + Intronic
1001091997 5:168748447-168748469 CCAGAGAGGGTGAGGGTTGTGGG + Intronic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002960199 6:1906951-1906973 CGAGAGGAGGCAAGGGTGGATGG + Intronic
1003326222 6:5093367-5093389 CTAGAGCATGTGACAGTGGAGGG + Intergenic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1006210516 6:32389781-32389803 GTAGAAAACGTGAAGGTGGATGG + Intergenic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1006924870 6:37648721-37648743 CAAGGGAAGGTGTGAGTGGAGGG + Intronic
1006927245 6:37663914-37663936 CTAGGCAAGGTGAGGGTAGGAGG + Intronic
1007398957 6:41592915-41592937 CTAGACTAGGTGAGGGGAGATGG - Intronic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1008054073 6:46928499-46928521 CTAGAGAAGGTGGGAGTCTATGG - Intronic
1010116845 6:72322844-72322866 CTGGAAATTGTGAGGGTGGAAGG + Intronic
1010941648 6:81926129-81926151 GTAGAGATGGTGGAGGTGGAGGG + Intergenic
1011552308 6:88540859-88540881 CTTGAGGAGGTCGGGGTGGAAGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1014030120 6:116691359-116691381 CTTGAGAAGCTGAGGTGGGAGGG - Intronic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1016418478 6:143858425-143858447 TTAGAGATGGTGAGGGTTTAAGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020885563 7:13815542-13815564 CTAGTGTAGGTGATGGTTGATGG + Intergenic
1021376924 7:19919971-19919993 CTAGAGACTGGGAGGGAGGAGGG + Intergenic
1021448046 7:20754548-20754570 ATAGAGAAAGTGGGAGTGGAAGG - Intronic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1021561288 7:21971277-21971299 CTCGAGAAGCTGAGGTGGGAGGG - Intergenic
1022400973 7:30037004-30037026 CTAGAGAAGCTGAGTGGGGGAGG + Intronic
1022567252 7:31415864-31415886 CCTGAGAAGGGCAGGGTGGAGGG - Intergenic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023506453 7:40904036-40904058 CCAGAGAGGCTGAGGGTGGTTGG - Intergenic
1023654060 7:42402433-42402455 AAAGTGATGGTGAGGGTGGAGGG - Intergenic
1023829125 7:44028977-44028999 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1025801323 7:64789225-64789247 CTAGGCAAGGTGTGGGAGGAGGG - Intergenic
1026830687 7:73608185-73608207 CCAGAGAAGGTGTGGGAGGTTGG - Intronic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1029739426 7:102483234-102483256 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029757427 7:102582413-102582435 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029775367 7:102681474-102681496 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1029809324 7:103031915-103031937 CTAGAGAGGGTAAGAGTGGAGGG - Intronic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032353201 7:131185053-131185075 CGAGAGGAGGAGAGGGTGGTGGG + Intronic
1033472919 7:141665327-141665349 ATAGAGGAGGTGAGCGGGGAGGG + Intronic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035374342 7:158397504-158397526 GAAGGGAAGGTGAGGGTGCAGGG - Intronic
1035382624 7:158449310-158449332 CAAGGGCAGGTGAGGGTGGTCGG + Intronic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037939737 8:22942500-22942522 GTAGAGATGGTGGGGGTGGTGGG - Intronic
1041502043 8:58549673-58549695 CTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1042564786 8:70100776-70100798 CTAGTGAAGGTGGGGCAGGAGGG - Intergenic
1042603031 8:70518138-70518160 CTAGGGAGGGTGAGGCAGGAGGG - Intergenic
1044152207 8:88795302-88795324 TTAGGGATGGTGAGGATGGAAGG + Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045364195 8:101460708-101460730 CTAGAGGTGGAGAGGGTGGGGGG - Intergenic
1045459365 8:102412616-102412638 CTAGGGGAGGTGAGGAAGGAGGG + Exonic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1048107864 8:131430974-131430996 CAAGAGACAGTGAGGTTGGAGGG - Intergenic
1048416473 8:134232697-134232719 AGAGAGAAGGTGAGGGAGAATGG - Intergenic
1048807655 8:138255503-138255525 GGAGAGAAGCTGAGGGTGGCTGG + Intronic
1049346614 8:142142628-142142650 CTACAGGAGATGAGGGTGAAAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052014077 9:23444485-23444507 CTAGAGTAGGTGAAGGTGGTTGG - Intergenic
1052474524 9:28941840-28941862 CAAAAGAAGATGAGGATGGATGG + Intergenic
1053146885 9:35718113-35718135 GTAAAGAAGCTGGGGGTGGAGGG - Intronic
1053329196 9:37188564-37188586 GTAGGGGAGGTGAGGGGGGAGGG - Intronic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1056856350 9:90132908-90132930 CTTGAGAAGCTGAGGATGTAGGG - Intergenic
1056943254 9:90973183-90973205 CTCGAGAGGGTGAGGTGGGAGGG - Intergenic
1056954771 9:91073208-91073230 CTAGAGGAGCTGAGGCTGGGCGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1058025186 9:100135212-100135234 GTAGGGAAGGTAAGGGAGGACGG + Intronic
1058732324 9:107862163-107862185 CTAGAGATTGGGAGGGAGGAGGG - Intergenic
1059053950 9:110959265-110959287 ACAGAGAAGGTAAGGATGGAAGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059636105 9:116172252-116172274 CTAGAGAGGTTTATGGTGGAGGG - Intronic
1059818244 9:117942359-117942381 CTAGAGAAGGTGGAGATGGCAGG + Intergenic
1060198009 9:121635676-121635698 CTAGAGAGGGTGGGGCTTGAGGG + Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061926619 9:133809026-133809048 ATTGAGAAGGTGAGGGCAGATGG - Exonic
1062540611 9:137040194-137040216 CCAGGGGAGGTGAGGGTGCAGGG + Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203746970 Un_GL000218v1:45274-45296 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1203563136 Un_KI270744v1:74206-74228 GGAGAGGAGGTGAAGGTGGAAGG + Intergenic
1185779347 X:2830813-2830835 CTAGGGAAGCTGAGGTGGGAGGG + Intronic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186726533 X:12364619-12364641 ATAGAGATGGTGAGGGAGGCAGG + Intronic
1187277736 X:17831004-17831026 GTAGAAAAGATGAGGATGGATGG - Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187808377 X:23146919-23146941 TTAGATGAGGTGAGGTTGGAAGG - Intergenic
1188145795 X:26611696-26611718 CTATTGAAGTTGAGAGTGGAAGG + Intergenic
1189408110 X:40743969-40743991 CTAGGGAAGGCCAGGATGGAAGG - Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190330137 X:49230661-49230683 TCTGAGAAGGTTAGGGTGGAGGG - Intronic
1191896137 X:65995324-65995346 CTAGAGGAGGTGGGGTTGGATGG + Intergenic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1194841040 X:98742454-98742476 GTAGAGAAGGACATGGTGGAAGG - Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195538419 X:106035080-106035102 TTAGAGGATGTGTGGGTGGAAGG - Intronic
1196045000 X:111247746-111247768 CTAGAGAAGTTGGGAATGGATGG - Intronic
1196716095 X:118812363-118812385 CTAGAGCAAGTGGGGGAGGAGGG - Intergenic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1198218004 X:134574409-134574431 CTAGAGAAGGAGTGGGGGAAGGG - Intronic
1198322063 X:135528016-135528038 CTAGAGAAGGGTAGGATTGAAGG + Intronic
1199445342 X:147913428-147913450 CAATAGAAGGTGCGTGTGGAAGG + Intronic
1199860705 X:151798404-151798426 CTAAATAAGGTGGGAGTGGAAGG + Intergenic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1201160295 Y:11160288-11160310 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1201290701 Y:12419663-12419685 CTAGGGAAGCTGAGGTAGGAGGG - Intergenic