ID: 1143481870

View in Genome Browser
Species Human (GRCh38)
Location 17:7231973-7231995
Sequence GCAGAATTTTGTGCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143481870_1143481873 24 Left 1143481870 17:7231973-7231995 CCTCACTGGGCACAAAATTCTGC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1143481873 17:7232020-7232042 AGATCCCAAAGCCCAGCCTTGGG 0: 1
1: 0
2: 2
3: 26
4: 251
1143481870_1143481872 23 Left 1143481870 17:7231973-7231995 CCTCACTGGGCACAAAATTCTGC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1143481872 17:7232019-7232041 CAGATCCCAAAGCCCAGCCTTGG 0: 1
1: 0
2: 1
3: 38
4: 309
1143481870_1143481874 25 Left 1143481870 17:7231973-7231995 CCTCACTGGGCACAAAATTCTGC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1143481874 17:7232021-7232043 GATCCCAAAGCCCAGCCTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143481870 Original CRISPR GCAGAATTTTGTGCCCAGTG AGG (reversed) Intronic
900224340 1:1525915-1525937 TCAGAAGTTTGAGCCCAGTCTGG - Intronic
900936156 1:5767416-5767438 GCTGAATTCTTTCCCCAGTGAGG - Intergenic
901419240 1:9139207-9139229 GCAGAGTTTGGTGCCAGGTGTGG + Intergenic
901907885 1:12430102-12430124 GCAGGATATTGTGGCCATTGAGG + Intronic
903067450 1:20708494-20708516 CCAGAATTATGTTCCCAGTTGGG + Intronic
903708330 1:25303318-25303340 GCAGACTTATGTGCACAGTGCGG + Exonic
903718784 1:25389095-25389117 GCAGACTTATGTGCACAGTGCGG - Exonic
908670002 1:66535312-66535334 GCAGAAATTTGTCCCCAGCCTGG + Intronic
909853199 1:80495579-80495601 GCAGATTTTTGGGCCGGGTGCGG - Intergenic
918099738 1:181363126-181363148 GCAGATTTTTGTGCCTAGTCTGG + Intergenic
920196756 1:204233010-204233032 CCAGAAGTTTGAGACCAGTGTGG - Intronic
920441347 1:205982990-205983012 GCAGAAAGTTGTGCCCTGTTGGG + Intronic
920908915 1:210195839-210195861 ACAGAATTTGGTGCCAAGAGTGG - Intergenic
921278152 1:213539499-213539521 GCAGAATTGAGAGCCCAGTCTGG - Intergenic
921943825 1:220872430-220872452 GCAGATTTCTCTCCCCAGTGTGG - Intergenic
921972156 1:221161793-221161815 TCAAAATTATGTGTCCAGTGAGG + Intergenic
922292964 1:224224122-224224144 TCAGAACTTAATGCCCAGTGTGG - Intergenic
922754629 1:228088883-228088905 GCAGCATTTAGAGCACAGTGTGG + Intronic
923588886 1:235301245-235301267 TGAAAATTTAGTGCCCAGTGTGG + Intronic
924118743 1:240774467-240774489 GAAGTATTTTGTGCCAGGTGCGG - Intergenic
924551252 1:245080013-245080035 GCTGAATTTTCTGCCGAGAGTGG + Intronic
1064572123 10:16704618-16704640 ACAGAATTCTGGGCCCTGTGAGG - Intronic
1065117796 10:22499083-22499105 ACAGAATCTTGTGGCCAGAGGGG + Intergenic
1068094244 10:52470357-52470379 GCAGAATGTGGTACCTAGTGTGG + Intergenic
1069452619 10:68529161-68529183 GCAGAAATTGGTGTTCAGTGAGG - Intergenic
1069739909 10:70680849-70680871 TCAGGATTTTGAGACCAGTGTGG - Intronic
1070364401 10:75722282-75722304 ACAGAATTTTATTCCAAGTGAGG - Intronic
1070715436 10:78717643-78717665 ACAGAATTTTGGGGCCAGTCTGG - Intergenic
1072996071 10:100245230-100245252 TCAGAATTTTGAGACCAGTCTGG - Intronic
1073127573 10:101161254-101161276 GGGGAATTCTGTGCCCTGTGTGG - Intergenic
1075874654 10:125796220-125796242 GCCCCATTGTGTGCCCAGTGCGG - Intronic
1077444463 11:2583865-2583887 GCAGAATCTTGTGCCTGGAGAGG + Intronic
1078252916 11:9632018-9632040 TCAGAATTTTGTGACCAGCCTGG - Intergenic
1078737611 11:14034960-14034982 GCAGAATAGTGAGTCCAGTGAGG - Intronic
1079134591 11:17769268-17769290 GCAGAACTTGGTGCCTTGTGAGG + Intronic
1081737672 11:45415380-45415402 GCTGAAATGTGTGACCAGTGAGG - Intergenic
1082913698 11:58407282-58407304 GCAGAGCTTTGTACACAGTGTGG + Intergenic
1083641866 11:64150003-64150025 GCAGGAGTTTCTGCTCAGTGTGG - Intronic
1084312327 11:68324345-68324367 AGAGACTTGTGTGCCCAGTGTGG + Intronic
1086822697 11:91454428-91454450 GCAGAATTTGGTATCCACTGGGG + Intergenic
1090590836 11:128265951-128265973 TCAGAATTTTGTGCCAGGAGTGG - Intergenic
1092340265 12:7669993-7670015 GCAAAATTTTGTCTCCAGGGTGG - Intergenic
1093180471 12:15961464-15961486 CCAGAAGTTTGAGACCAGTGTGG + Intronic
1094002725 12:25713271-25713293 GCAGATTTCTCTCCCCAGTGTGG + Intergenic
1094783810 12:33822332-33822354 TCAGCATTTGCTGCCCAGTGTGG - Intergenic
1095084001 12:38040288-38040310 GGATATTTTTGTCCCCAGTGAGG + Intergenic
1096663633 12:53146644-53146666 CCAGAAGTTTGAGACCAGTGTGG + Intergenic
1097349258 12:58530012-58530034 GCAGAATTTTGTGACAATTCTGG - Intergenic
1097703090 12:62840184-62840206 GCAAGTTTTTGTGTCCAGTGAGG + Intronic
1100885649 12:99066940-99066962 GCAGCAGTCTGTGCTCAGTGAGG + Intronic
1101438264 12:104682745-104682767 GCAGAATTTATTTCCCAATGAGG - Intronic
1102780348 12:115559044-115559066 CCAGAAGTTTGAGTCCAGTGTGG - Intergenic
1104828443 12:131731458-131731480 GCAGAATTTGGGGTCCTGTGTGG + Intronic
1107364717 13:39657723-39657745 GCAGAATTTAGTGTACAATGGGG + Intronic
1108415654 13:50195960-50195982 GCAGAATTTGGTGTCTGGTGAGG + Intronic
1108481350 13:50875467-50875489 GCAGATTGCTGTCCCCAGTGTGG - Intergenic
1108999535 13:56780110-56780132 GCAGAATTTTGTAACAATTGTGG - Intergenic
1109358204 13:61260781-61260803 GCAGGAGTTTGAGACCAGTGTGG - Intergenic
1110455046 13:75682069-75682091 GCAGAACATTGTGGCCAATGTGG - Intronic
1112392860 13:99001267-99001289 TCAAAATTTTGTTCTCAGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114711729 14:24785444-24785466 GCAGAATTTTGTATCCACGGGGG - Intergenic
1114750455 14:25198973-25198995 AAAGAATTATGTGCCCATTGTGG + Intergenic
1114757303 14:25274070-25274092 GCAGATGTATGTTCCCAGTGAGG + Intergenic
1117008893 14:51450359-51450381 CCAGAATTTTTTGGGCAGTGTGG + Intergenic
1118451244 14:65904523-65904545 TTAACATTTTGTGCCCAGTGAGG + Intergenic
1120121235 14:80681892-80681914 GCAGGATTTTGAGACCAGTCTGG + Intronic
1120348769 14:83326399-83326421 TCATAATTTTGTCCCCAGTGAGG - Intergenic
1125192992 15:37015191-37015213 GCAGAAATCTGTGCCCTCTGGGG - Intronic
1127629669 15:60815199-60815221 ACATAATTTTGTGCCCATGGAGG - Intronic
1130611590 15:85366205-85366227 GCAGATTTTTGTACCAAGGGTGG + Intergenic
1131103941 15:89717348-89717370 TCAAAATCTTGGGCCCAGTGTGG - Intronic
1131228980 15:90646776-90646798 GCAGAGTTTGGAGCCCTGTGGGG - Intergenic
1133257596 16:4526855-4526877 GCAGAATCTTGCACCGAGTGGGG + Intronic
1137747819 16:50835970-50835992 ACAGAAACCTGTGCCCAGTGGGG + Intergenic
1140177055 16:72672651-72672673 CCAGAAATTTGAGACCAGTGTGG + Intergenic
1141377955 16:83549005-83549027 GCATAATTTTCTTCCCTGTGTGG + Intronic
1142135699 16:88451102-88451124 GCAGGATGTTGAGCCCGGTGTGG - Intergenic
1142340222 16:89517149-89517171 GAAGAATTGTGTGGCCTGTGCGG + Intronic
1143481870 17:7231973-7231995 GCAGAATTTTGTGCCCAGTGAGG - Intronic
1144635739 17:16907816-16907838 GCACCATTTTGAGCTCAGTGTGG - Intergenic
1145731438 17:27190159-27190181 GGACAATTCTGTGCCCACTGAGG + Intergenic
1146306095 17:31730924-31730946 GGTGAATTTTGTCCCAAGTGTGG - Intergenic
1146401891 17:32506007-32506029 CCAGAAGTTTGAGACCAGTGTGG + Intronic
1149534454 17:57421672-57421694 CCAGAAGTTTGAGACCAGTGTGG + Intronic
1150865232 17:68842131-68842153 GCAGAATTTTGTCCTCATTGGGG + Intergenic
1153733024 18:8034649-8034671 GCAGAACTGTGAGCCCAGAGTGG - Intronic
1153747514 18:8195027-8195049 GCAGAATGTTGTCCTCAGGGTGG - Intronic
1156082825 18:33359864-33359886 GCAGAAGTTTGTGGGCAATGTGG - Intronic
1156466370 18:37350110-37350132 ATAGAATTTTATGTCCAGTGAGG + Intronic
1156830328 18:41484032-41484054 GCAGAATTCTCTGCACAGCGGGG - Intergenic
1157657571 18:49406347-49406369 GCAGGATTTTGAGACCAGTCTGG + Intronic
1157745887 18:50135116-50135138 GCAGAATTTTGTTGGCAGTTGGG - Intronic
1158798683 18:60879203-60879225 CCAGAATTTTGAGACCAGTCTGG - Intergenic
1159828028 18:73238984-73239006 GAAGAAAGTTGTGGCCAGTGTGG - Intronic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1164401994 19:27909318-27909340 GCAGACTGCTGTGCCCACTGGGG + Intergenic
925797909 2:7566779-7566801 GCAGAAAGGAGTGCCCAGTGTGG - Intergenic
927566315 2:24116399-24116421 CCAGGAGTTTGAGCCCAGTGTGG - Intronic
927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG + Intergenic
929586343 2:43117256-43117278 GCTGAATGCTGTGCCCACTGGGG + Intergenic
931848198 2:66226162-66226184 ACAGAATTTCGGGCCCAGAGAGG - Intergenic
935018298 2:99205537-99205559 GCTGAATTCTTTCCCCAGTGAGG + Intronic
936621953 2:114109277-114109299 TCAGAATTGAGTGGCCAGTGTGG + Intergenic
936827930 2:116604259-116604281 GCAGAAGTTTGTGCCAGGGGTGG + Intergenic
937701268 2:124865653-124865675 GCAGATTCTTGGGCCAAGTGTGG + Intronic
940846732 2:158650540-158650562 GCTGAAATTTGTCCCCAGTTGGG - Intronic
942210600 2:173665509-173665531 GCAGGATTTTGAGCAGAGTGAGG + Intergenic
942557721 2:177188830-177188852 CCCGAATTCTTTGCCCAGTGTGG - Intergenic
942819007 2:180088790-180088812 GCAGTATGTTGTTCCCTGTGAGG + Intergenic
943684241 2:190800271-190800293 GTAGTGTTTTGTTCCCAGTGAGG - Intergenic
944150689 2:196554973-196554995 GCAGAGTGTTGTGCACAGTCTGG - Intronic
1169086671 20:2830239-2830261 GCAGAAGTTTGAGACCAGTCTGG - Intergenic
1172569286 20:35956380-35956402 GCAGGAATTTGGGTCCAGTGTGG - Intronic
1172790191 20:37498719-37498741 TCAAATTTTTGTGCCCAGAGAGG + Intronic
1173560380 20:44000845-44000867 GAAGAAGTTTGTTCCCAGGGAGG + Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1177308146 21:19348144-19348166 GCAGATATTTCTTCCCAGTGTGG - Intergenic
1180685309 22:17661699-17661721 GCATAATTATGTGCCGGGTGTGG + Intronic
1181821175 22:25476937-25476959 GCAGAATTCAGAGCCCAGTGTGG + Intergenic
1182811606 22:33121649-33121671 GCAGAAATTTGGGCCTTGTGGGG + Intergenic
1182935927 22:34221533-34221555 GCAAAAGGTTGAGCCCAGTGTGG + Intergenic
950552189 3:13673344-13673366 GCAGAATTCTGTGACCCATGTGG - Intergenic
950619741 3:14195330-14195352 GTAGAATTGTGTGCCCAGGAAGG + Intronic
951056748 3:18155827-18155849 GGAGAATTTTTTTCCCATTGGGG + Intronic
952055928 3:29446145-29446167 ACAGAATTTTGAGTCCATTGTGG + Intronic
952138585 3:30452930-30452952 GCAGAATTTTCTGACCTCTGAGG + Intergenic
952897283 3:38085980-38086002 GCAGAAGTCAGTGCCCATTGTGG - Intronic
955594900 3:60578146-60578168 GCACACTTTAGTGCCCAGTGTGG + Intronic
956162905 3:66373501-66373523 GGAGAACTTTGTGGCCAGAGTGG + Intronic
957453417 3:80410230-80410252 TCAGAAGTTTGAGACCAGTGTGG + Intergenic
960805061 3:121575702-121575724 GCAGGAGTTTGAGACCAGTGTGG + Intronic
961855756 3:129869259-129869281 GGAGGGTTTTGTGCCCAGAGAGG + Intronic
962307020 3:134297420-134297442 TCAGAAGTTTGAGACCAGTGTGG - Intergenic
964483653 3:157165232-157165254 CCAGAAGTTTGAGCCCAGTCTGG + Intergenic
965031602 3:163376125-163376147 GCAGAATTTTGAGCACTGTCTGG - Intergenic
965094170 3:164202094-164202116 GCAGAAATTTGTACCCAAAGTGG + Intergenic
965330118 3:167362452-167362474 GGAGAAGTTTGGGCTCAGTGTGG - Intronic
966801410 3:183767590-183767612 TCAGAAGTTTGAGACCAGTGTGG - Intronic
967653143 3:192011351-192011373 GCAGAACTTTGTGTTCAGTGTGG - Intergenic
969799862 4:9555304-9555326 GCAGATTTTCCTCCCCAGTGTGG + Intergenic
969907821 4:10413681-10413703 GCAGATATATGAGCCCAGTGGGG + Intergenic
974059373 4:57017046-57017068 GCAGGATCTTGTGGCCAGTGGGG + Exonic
976620038 4:87118148-87118170 GCTAAATTTTGTGCCAAGAGAGG - Intronic
979982988 4:127279419-127279441 GCAGATTGCTGTCCCCAGTGTGG + Intergenic
981751767 4:148099248-148099270 GCAGAATATTATGCCAAGAGTGG + Intronic
982582181 4:157193171-157193193 GCTGATTTTTGTGGGCAGTGGGG - Intergenic
990081061 5:51914083-51914105 CCAGAAGTTTGTGACCAGTCTGG + Intergenic
991664904 5:68989976-68989998 GCATAATTTTGTGACCAGACTGG - Intergenic
992110574 5:73488737-73488759 AAAGAATTTAGTTCCCAGTGAGG + Intergenic
992224324 5:74604754-74604776 TCAGAAATTTGAGACCAGTGTGG + Intergenic
993383321 5:87233104-87233126 GCAGATTGTTCTTCCCAGTGTGG - Intergenic
993411270 5:87576334-87576356 GCTGAATTTTTTCCCCAGTAAGG + Intergenic
994577475 5:101596898-101596920 GCAGAAATTTGTTTCCAGTAGGG - Intergenic
994978855 5:106846343-106846365 GCAGAAGTTTGTGACCAGCCTGG + Intergenic
995604782 5:113841475-113841497 GCAAAATTTTATACCCATTGTGG - Intergenic
997354790 5:133255298-133255320 GCAGAAGTCTGTGCCCACAGAGG + Intronic
998060766 5:139117102-139117124 GAAGTATTTTGTGCTCAGTGAGG - Intronic
999841336 5:155430904-155430926 GCAGATTGTTCTCCCCAGTGCGG + Intergenic
1001655701 5:173347832-173347854 TCAGAAGTTTGAGACCAGTGTGG + Intergenic
1002464585 5:179400448-179400470 GCAGAAGTTTGTTGCCAGGGTGG + Intergenic
1002509040 5:179700838-179700860 CTTGAATTGTGTGCCCAGTGTGG + Intronic
1003082117 6:3029352-3029374 ACAGAAGTTTGAGACCAGTGTGG + Intergenic
1005986092 6:30876196-30876218 GTGGAATATTGTGCCAAGTGCGG - Intergenic
1007044923 6:38763384-38763406 GCAGAATATTGTGACAAGAGAGG + Intronic
1007724002 6:43903387-43903409 CCAGAAGTTTGAGACCAGTGTGG + Intergenic
1008640405 6:53456555-53456577 GCAGAACTTAGTGCCCTGTAGGG - Intergenic
1009245875 6:61237108-61237130 ACAGAATTCTTTTCCCAGTGAGG + Intergenic
1011580769 6:88861444-88861466 GCAGAATTTACTGAGCAGTGAGG - Intronic
1013026946 6:106284562-106284584 TCAGGATTTTGAGACCAGTGTGG - Intronic
1013095995 6:106945162-106945184 GCAGAGTAATGTGCCCAATGTGG - Intergenic
1013479541 6:110542256-110542278 GCAGAATTCTGTATCCAGAGGGG - Intergenic
1014578663 6:123107288-123107310 CCAGAATTGTGTGACAAGTGTGG - Intergenic
1014834826 6:126149193-126149215 GCAGAATGTTTTGCCCAGAACGG + Intergenic
1015314685 6:131805406-131805428 ACAGGATTGTGTGCCCAGTGTGG - Intergenic
1017894287 6:158665817-158665839 ACAGAAGTTTGGGCCAAGTGTGG + Intronic
1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG + Intronic
1024613026 7:51083300-51083322 GCTGGATCTGGTGCCCAGTGAGG - Intronic
1026417401 7:70196757-70196779 GCAAACTTTTGTGCACATTGTGG + Intronic
1026469558 7:70683487-70683509 GCAGTATCTTGTTCCCAGTGAGG + Intronic
1029867527 7:103650832-103650854 TCAGAAGTTTGAGACCAGTGTGG - Intronic
1038024791 8:23578727-23578749 CCAGAATTATGTGCCCAGTGAGG + Intergenic
1039332881 8:36558646-36558668 CCAGTATTTTGAGACCAGTGTGG - Intergenic
1040115472 8:43613178-43613200 GGACAATTTGGTGCCCATTGAGG + Intergenic
1040474697 8:47765601-47765623 GCTGAATTCTTTCCCCAGTGAGG + Intergenic
1040593194 8:48815233-48815255 GCAGGACTCTGTTCCCAGTGTGG + Intergenic
1041365273 8:57096257-57096279 GCAAAATTGTGTGGCCACTGTGG - Intergenic
1044334349 8:90961482-90961504 CCAGAATTTCATGTCCAGTGGGG + Intronic
1044906748 8:97012508-97012530 GCAGAGTTATGTGCTGAGTGTGG - Intronic
1045118620 8:99012102-99012124 GCAGAAGTTTGAGACCAGTCTGG - Intergenic
1047987383 8:130248878-130248900 GCAGAATTTTGTGGCCTCTTGGG - Intronic
1048131640 8:131704124-131704146 GCAGAATTTTGTACCTAGGCTGG + Intergenic
1049701403 8:144015258-144015280 TCAGAAGTTTGAGACCAGTGTGG - Intronic
1050826632 9:9954084-9954106 TCAGAAGTTTGAGACCAGTGGGG + Intronic
1056566804 9:87779900-87779922 TCAGAAGTTTGTGACCAGTCTGG + Intergenic
1057519504 9:95750351-95750373 GCACCATTTTGTGCCCTGGGCGG + Intergenic
1061191637 9:129085796-129085818 CCAGAATCTTGGGCTCAGTGCGG - Intronic
1187586558 X:20668917-20668939 GCAGAATTTATTGCCCAGAAAGG - Intergenic
1188678765 X:32976009-32976031 TCAGAAGTTTGTGACCAGTCTGG + Intronic
1189207106 X:39251085-39251107 TCACTATTTTTTGCCCAGTGTGG - Intergenic
1192359041 X:70426858-70426880 GCAGAATCTTGGGACCTGTGGGG - Exonic
1197338038 X:125232217-125232239 GTACAATTTTGAGGCCAGTGAGG - Intergenic
1197464964 X:126792481-126792503 GCTGTGTTTTGTGACCAGTGAGG + Intergenic
1199511733 X:148630271-148630293 GCACATTTTTAAGCCCAGTGAGG - Intronic
1200289033 X:154854289-154854311 GCAGATTGTTCTCCCCAGTGTGG + Intronic
1201644565 Y:16215632-16215654 GCAGAATTCTGTGCCCAAGAGGG - Intergenic
1201658250 Y:16369689-16369711 GCAGAATTCTGTGCCCAAGAGGG + Intergenic
1202596760 Y:26548430-26548452 GCAGGGATTTCTGCCCAGTGAGG - Intergenic