ID: 1143492030

View in Genome Browser
Species Human (GRCh38)
Location 17:7290251-7290273
Sequence CTCTATAGGCTGCTGCTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143492018_1143492030 26 Left 1143492018 17:7290202-7290224 CCTCTCCTGAACTTGGGGAACTG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG 0: 2
1: 0
2: 0
3: 11
4: 152
1143492023_1143492030 -8 Left 1143492023 17:7290236-7290258 CCAGCATCCCCTCACCTCTATAG 0: 1
1: 0
2: 2
3: 8
4: 171
Right 1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG 0: 2
1: 0
2: 0
3: 11
4: 152
1143492020_1143492030 21 Left 1143492020 17:7290207-7290229 CCTGAACTTGGGGAACTGGCTCC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG 0: 2
1: 0
2: 0
3: 11
4: 152
1143492021_1143492030 0 Left 1143492021 17:7290228-7290250 CCCATATTCCAGCATCCCCTCAC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG 0: 2
1: 0
2: 0
3: 11
4: 152
1143492022_1143492030 -1 Left 1143492022 17:7290229-7290251 CCATATTCCAGCATCCCCTCACC 0: 1
1: 0
2: 2
3: 27
4: 353
Right 1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG 0: 2
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143492030 Original CRISPR CTCTATAGGCTGCTGCTGGT TGG Exonic
901062236 1:6477053-6477075 CTCCATAGGCAGTTGATGGTGGG + Intronic
902060484 1:13638041-13638063 CTGTATAGGCTTCTGCTTCTGGG + Intergenic
905094592 1:35458373-35458395 CCCTATAGTCAGCTGCTGTTTGG - Intronic
909147059 1:71948706-71948728 CACTAGATGCTGCTGCTGGATGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
911375891 1:97050901-97050923 CTCTATAGGCTGTTCCTAATGGG - Intergenic
911586060 1:99692302-99692324 CTCTAATGGCTGTTGCAGGTTGG - Intronic
922074515 1:222230141-222230163 ATCTATAGGATGCTGCAGCTGGG + Intergenic
1065072346 10:22038885-22038907 CTCTATAGGCTGTTCCAGGAAGG - Intergenic
1065732534 10:28722490-28722512 CTCTTTCGGCTGCTGCTGATGGG - Intergenic
1067788077 10:49266190-49266212 CTTTATTGGCTTCTGCAGGTAGG - Intergenic
1068663315 10:59646714-59646736 CTCCATGGGCCGCTTCTGGTGGG - Intergenic
1073065399 10:100755835-100755857 CTCTAGGGGCTGCTCCTGTTTGG - Intronic
1073126345 10:101152619-101152641 GTCCATAAGCTGCTGCTGATGGG + Intergenic
1073192117 10:101659026-101659048 CTCTATAGCCTGCTTCGGCTTGG - Intronic
1075629532 10:123992474-123992496 CTCTATAGGCTGCTGCTGGTTGG - Intergenic
1078143337 11:8707231-8707253 CTCTTTGGGCTGCTGGCGGTGGG - Intronic
1080591991 11:33732467-33732489 CTGTATAGGCTTCTGCTTCTGGG - Intronic
1081531320 11:43961531-43961553 CTATCTGGGTTGCTGCTGGTAGG - Intergenic
1089062240 11:115634759-115634781 CTCTATCGGGTGGTACTGGTAGG + Intergenic
1091668011 12:2433109-2433131 GTGTCCAGGCTGCTGCTGGTGGG + Intronic
1092164011 12:6331578-6331600 CTCTATGGGGTGGTGCTGGAAGG + Intronic
1093336338 12:17910005-17910027 CTCTGTAGGCAACTGGTGGTTGG + Intergenic
1094295517 12:28900498-28900520 CTGTATAGGCTTCTGCTTCTGGG - Intergenic
1094647484 12:32339945-32339967 CTGTAGTGGCTGCTGCTGTTAGG + Intronic
1100594438 12:96059849-96059871 CTCTATACACTGCTGTTGGATGG + Intergenic
1104602832 12:130164464-130164486 ATCTTTATGCTGCTGGTGGTGGG + Exonic
1108910857 13:55550060-55550082 CTCTATAGGGTTCTGCTTCTGGG - Intergenic
1109318976 13:60786348-60786370 CTCAATACCTTGCTGCTGGTTGG - Intergenic
1113701292 13:112390581-112390603 CTGTATAGGCTTCTGCTTCTGGG + Intronic
1114821133 14:26020385-26020407 TTCTGTAGGCTGCTGCTTCTGGG - Intergenic
1121253181 14:92514227-92514249 CACTTTAGGCTGCTGGTGGACGG + Intronic
1121311448 14:92937533-92937555 CTCCATGGCCTCCTGCTGGTTGG - Exonic
1122760461 14:104021079-104021101 CTGTATAGGCTGCTGCTTCTGGG + Intronic
1122861786 14:104585893-104585915 CTTTTTGGGCTGGTGCTGGTGGG - Intronic
1125390559 15:39188053-39188075 CTCTAGTTGCTGCTGATGGTAGG - Intergenic
1129082490 15:73052727-73052749 CTCTACTGCCTGCTGCTGCTCGG + Exonic
1129494941 15:75970532-75970554 CTCTATGGGCAGTTACTGGTTGG + Intronic
1130223499 15:82041098-82041120 CTTAATAGGCTTCTGCTTGTAGG - Intergenic
1131514067 15:93065889-93065911 CTCTGTAGGCTGTTGCTGGCTGG + Intronic
1135342454 16:21660870-21660892 CTGTATAGGCTTCTGCTTCTAGG + Intergenic
1135976525 16:27112009-27112031 CTCTACAGTCTGCTGCCGGGTGG + Intergenic
1139743320 16:69054279-69054301 CACTCCAGGCTTCTGCTGGTTGG + Intronic
1143492030 17:7290251-7290273 CTCTATAGGCTGCTGCTGGTTGG + Exonic
1145012279 17:19376437-19376459 CTCTATAGCCTGCTACTGGGAGG + Intronic
1149595536 17:57862586-57862608 CTCATCAGGCTGCTGCTGTTAGG - Exonic
1152304032 17:79510897-79510919 CTCCCTAGGATGCTGCTGCTTGG - Intronic
1152504579 17:80739502-80739524 GTGTATTGGCTGCTGCTGGAGGG - Intronic
1153874752 18:9359175-9359197 GTCTGTTGGCAGCTGCTGGTTGG + Intronic
1157055468 18:44223283-44223305 TTCTATTGGCTTCTCCTGGTAGG - Intergenic
1157306607 18:46521979-46522001 CTCTAAGGGGTGCTGCAGGTAGG + Intronic
1160956494 19:1694895-1694917 CTCTGAAGGCTGATGCTGGAGGG + Intergenic
1161222891 19:3126161-3126183 CTCTGGTGGCTGCTGCTGGGAGG + Intergenic
1161599209 19:5170595-5170617 CTCTACTGGCTGCTGCAGGGAGG + Intronic
1166205414 19:41265673-41265695 CTCTTGAGGCTGCTGCTGACTGG + Intronic
1167616262 19:50535867-50535889 CTCTCTGGGCTCCTGGTGGTGGG - Intronic
1167825698 19:51971108-51971130 CTTTAAAGGATACTGCTGGTGGG + Intronic
930019058 2:46990101-46990123 CTCTTCAGCCTGCTGCTGTTGGG + Intronic
931955314 2:67418088-67418110 CTGTATAGGCTTCTGCTTCTTGG + Intergenic
932117976 2:69070330-69070352 CTCTAAATGCTGCTCCTGATGGG - Intronic
932476367 2:72008857-72008879 GTCCAGAGGCTTCTGCTGGTTGG - Intergenic
932989108 2:76764746-76764768 CTCTATAGTCCTCTCCTGGTGGG - Intronic
937360171 2:121224174-121224196 GTCCACAGGCTTCTGCTGGTTGG + Exonic
938092235 2:128441382-128441404 CTGCCTAGGCTGCTGCTGTTGGG + Intergenic
941246214 2:163100900-163100922 CTTTATTGGCTGCAGCTGATCGG + Intergenic
941361566 2:164557940-164557962 CTCTTTAGCCTGTTGCTGGATGG - Intronic
942203088 2:173592092-173592114 CTATATAGGCTTCTGCTTCTGGG + Intergenic
942658172 2:178236647-178236669 CTCCAAAGACTGATGCTGGTAGG + Intronic
943579932 2:189673254-189673276 CTTTATCGGATGCTGCTGCTCGG - Intergenic
944079029 2:195764804-195764826 ATCTATAGACTGCTTTTGGTAGG - Intronic
946017720 2:216617432-216617454 TTCTGGAGGCTGCTGGTGGTTGG - Intergenic
947376118 2:229496980-229497002 ATGTATATGCTGCTGCTGTTGGG - Intronic
948674490 2:239588966-239588988 CTCTACGGGCTCCAGCTGGTGGG + Intergenic
1171033988 20:21702220-21702242 CCCTGCGGGCTGCTGCTGGTGGG + Intergenic
1172790359 20:37500696-37500718 CTTTAGAGGCAGCTGCTGTTAGG - Intronic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1174366168 20:50057742-50057764 CCCTAAATGCTGCTGGTGGTTGG - Intergenic
1175419945 20:58825186-58825208 CTCAACAGGCTTCCGCTGGTTGG + Intergenic
1175503243 20:59465031-59465053 CTGTATAGGCTTCTGCTTCTGGG - Intergenic
1175874675 20:62223741-62223763 CTCTGGAGGCTGCTCCTGGGTGG - Intergenic
1176255778 20:64152176-64152198 CTGTGTTGGCTGCTGCAGGTCGG + Intronic
1176312317 21:5158684-5158706 CTCTTGAGGCTGCTGCTGTCCGG + Intergenic
1179574779 21:42301261-42301283 CTGTAGAGGCAGCTGCTAGTGGG + Intergenic
1179717229 21:43295660-43295682 GTCTGTTGGCTGCTGCTGGCTGG + Intergenic
1179844731 21:44103346-44103368 CTCTTGAGGCTGCTGCTGTCCGG - Exonic
1182197678 22:28535848-28535870 CTGTATAGGCTTCTGCTCCTGGG - Intronic
1182434101 22:30319198-30319220 CTTTCTAGGCTCCTGCAGGTGGG + Intronic
1183489977 22:38110979-38111001 CTCCAGGGGCTGCTGCTGCTGGG - Intergenic
1184645413 22:45892310-45892332 CTCCAGAGGCTGCTGCGTGTGGG - Intergenic
949526900 3:4913643-4913665 CTGTATAGGCTTCTGCTTCTGGG + Intergenic
949620461 3:5805658-5805680 CTCTAAAGCCTGCTGGTGTTGGG + Intergenic
950205440 3:11076721-11076743 CTCCCTAAGCTGCTGTTGGTGGG + Intergenic
951205270 3:19919641-19919663 CTGTCTTGGCTGCTGCTGCTTGG + Intronic
953906161 3:46869197-46869219 CTCTTTGGGAAGCTGCTGGTGGG - Intronic
954035461 3:47848776-47848798 TTCTGTAGGCTGCTGCTGAAGGG - Exonic
961734942 3:128995422-128995444 GTCTCCAGGCTGCTGCAGGTGGG - Intronic
962906089 3:139804370-139804392 CTCACTTGGCTGCTGCTGGGTGG + Intergenic
962968479 3:140376339-140376361 CCTTCTAGGCTGCTGCAGGTAGG + Intronic
963204616 3:142619992-142620014 CTCGATAGGGTGCTGATTGTGGG - Intronic
963466276 3:145686438-145686460 CTCCAAAAGCAGCTGCTGGTGGG - Intergenic
964341498 3:155713321-155713343 CTCCAGAGGCTCCTGCTGGAGGG - Intronic
968761473 4:2444514-2444536 CTTGATAGGCTGATGATGGTGGG + Intronic
972350490 4:38231912-38231934 CCCTGTAGGCTGCTTATGGTAGG - Intergenic
973729338 4:53808646-53808668 CTCTAGAAGCTTCTGCTGGAGGG + Intronic
974753852 4:66178089-66178111 TTTTATAGGCTGCTGCTAGAGGG + Intergenic
977989449 4:103423128-103423150 CTCTCTAGGCAGGTGATGGTGGG + Intergenic
979122285 4:116919147-116919169 CTCTACAGGCTTCTGCTTCTGGG - Intergenic
981647834 4:147020112-147020134 CTATACATGCTGCTGCTGCTGGG + Intergenic
983772900 4:171572524-171572546 CTCAAGAGTCTGCTGCTGTTGGG - Intergenic
986352759 5:6895645-6895667 TTCTATAGGATTCTGGTGGTCGG + Intergenic
992184873 5:74234244-74234266 CTGTATAGGCTTCTGCTTCTAGG + Intergenic
992189783 5:74280481-74280503 CTCTAGAGGGTGCTGGTGGTTGG - Intergenic
992354010 5:75961255-75961277 GTCAATGGGCTGCTGCTGTTTGG + Intergenic
993430294 5:87824662-87824684 GCCTAGAGGCTGCTGCAGGTAGG - Intergenic
999738529 5:154531323-154531345 CTGTATAGCCAGCTTCTGGTTGG - Intergenic
1000808762 5:165834544-165834566 CTCAGTAGGCTGCTCGTGGTAGG + Intergenic
1001090528 5:168736858-168736880 GTCTATAGTCTGCTGCTTATTGG + Intronic
1002404141 5:179015974-179015996 CTCCTTAAGCTCCTGCTGGTTGG + Intergenic
1003837924 6:10091881-10091903 CTATATAGGCTTCTGCTTTTGGG + Intronic
1007201482 6:40113474-40113496 CTCTATAGGCTGATGCTTCAGGG - Intergenic
1007658578 6:43468114-43468136 CTCTATTGTCTGCAGCTGGGTGG + Intergenic
1007995714 6:46305734-46305756 CTCCATAGACAGCTGCTGGAGGG + Intronic
1008840133 6:55892991-55893013 CTCTATTAGCTGCTGGTGGCTGG + Intergenic
1014853091 6:126365365-126365387 CTCTACAGGCTTCTGCTTCTGGG + Intergenic
1015873218 6:137797906-137797928 CTGTATAGGCTTCTGCTTCTGGG + Intergenic
1021510866 7:21430469-21430491 CTGTAAAGGCTGCTGCTGGATGG - Exonic
1023164852 7:37333447-37333469 CTCTGTAGGTGGGTGCTGGTGGG - Intronic
1024504236 7:50148045-50148067 CACTTTAGACTGCTGCTGATAGG - Intronic
1025252962 7:57364244-57364266 CCCTCTTGGCTGCTGCTGGTGGG + Intergenic
1026104781 7:67412114-67412136 CTCTGTGGGCTGCAGATGGTGGG + Intergenic
1028498941 7:91496568-91496590 CTGTATAGGCTTCTGCTGCTGGG - Intergenic
1032533723 7:132643427-132643449 CTCTAGAGGCTGCTTCGTGTGGG - Intronic
1033791020 7:144792345-144792367 CCCCAAAGGTTGCTGCTGGTTGG - Intronic
1034936436 7:155203502-155203524 CTCTCCAGGCTGGTGCGGGTGGG - Intergenic
1039550384 8:38439182-38439204 CTCTAGAGGCTGCATCTGCTGGG + Intronic
1044525681 8:93248185-93248207 CTGTATAGGCTTCTGCTTCTGGG - Intergenic
1045870065 8:106916325-106916347 GTCTGTAGGCTGCTGCTGCCAGG + Intergenic
1048677949 8:136805846-136805868 CTCTAAAGCCTGCTGCTTGGAGG - Intergenic
1048930935 8:139315021-139315043 CTCTCTGGGCTGCGGCTGATGGG + Intergenic
1049668577 8:143859593-143859615 CTCTACATGCTGCAGCTGGCAGG - Exonic
1049668993 8:143861195-143861217 CTCTACATGCTGCAGCTGGCAGG - Exonic
1049669408 8:143862797-143862819 CTCTACATGCTGCAGCTGGCAGG - Exonic
1049669819 8:143864390-143864412 CTCTACATGCTGCAGCTGGCAGG - Exonic
1049670235 8:143865998-143866020 CTCTACATGCTGCAGCTGGCAGG - Exonic
1049688267 8:143947909-143947931 CTCTCTGGGCTGCTCCTGGCAGG + Intronic
1050050705 9:1598221-1598243 TTCTATAGGATGCTGCTGCTGGG + Intergenic
1051378913 9:16435522-16435544 CTCCATTGGCTGCTCCTGCTGGG - Intronic
1056455648 9:86756842-86756864 CTCTATGGGCTGATGCTGGAGGG + Intergenic
1056765750 9:89443544-89443566 CTCTGGCGGCTGCTGCTGGCCGG - Intronic
1057277164 9:93682081-93682103 GACTACAGCCTGCTGCTGGTTGG + Intergenic
1057280603 9:93708534-93708556 CTCCAGAGGGTGCTGCTGGGAGG + Intergenic
1058449706 9:105084570-105084592 CTCTAAAGCCTGCTACTGGGAGG + Intergenic
1059249296 9:112874001-112874023 CTCTGTAGGCTGGTCCTAGTAGG + Exonic
1059428367 9:114235462-114235484 CTCACAAGGCTGCTGCTGGCCGG + Intronic
1059746588 9:117207119-117207141 CCCTGCAGGCTGCTCCTGGTGGG + Intronic
1059925884 9:119208721-119208743 CTCTCTAGGCAGCTGGTGGTTGG + Exonic
1060067663 9:120517349-120517371 CTCTGGTGGCTGCTGCTGATAGG - Intronic
1186908876 X:14140250-14140272 CTCTCTAGGCAGCTTCTTGTAGG - Intergenic
1187200343 X:17128388-17128410 CATTATAGGCTGCTGGAGGTGGG + Intronic
1188721830 X:33531714-33531736 CTCTTTCTGCTGCTGCTGCTTGG - Intergenic
1189227801 X:39427908-39427930 CTCTAAAGTGTGCTGCTGGCAGG + Intergenic
1195931528 X:110082089-110082111 TGCTATAGCCTGCTGCTGGAAGG + Intronic
1197147794 X:123188284-123188306 GTCTCTAGGCAGCTGCTGCTTGG + Intronic
1200963311 Y:9014419-9014441 CTCCTTGGGCTGCTGCTGCTTGG - Intergenic