ID: 1143496474

View in Genome Browser
Species Human (GRCh38)
Location 17:7315427-7315449
Sequence CCGACCTCACAGGTGAAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143496462_1143496474 17 Left 1143496462 17:7315387-7315409 CCGGCGGCCCGGCCGAGTCCTTC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496467_1143496474 5 Left 1143496467 17:7315399-7315421 CCGAGTCCTTCCGGAGTCACGGC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496464_1143496474 10 Left 1143496464 17:7315394-7315416 CCCGGCCGAGTCCTTCCGGAGTC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496470_1143496474 -1 Left 1143496470 17:7315405-7315427 CCTTCCGGAGTCACGGCGGCGGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496465_1143496474 9 Left 1143496465 17:7315395-7315417 CCGGCCGAGTCCTTCCGGAGTCA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496459_1143496474 30 Left 1143496459 17:7315374-7315396 CCCTGCGTCACATCCGGCGGCCC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496460_1143496474 29 Left 1143496460 17:7315375-7315397 CCTGCGTCACATCCGGCGGCCCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1143496471_1143496474 -5 Left 1143496471 17:7315409-7315431 CCGGAGTCACGGCGGCGGCCGAC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143496474 Original CRISPR CCGACCTCACAGGTGAAAGA AGG Exonic