ID: 1143497678

View in Genome Browser
Species Human (GRCh38)
Location 17:7321708-7321730
Sequence ACACTAGCACCGGGGGAGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143497678_1143497685 -4 Left 1143497678 17:7321708-7321730 CCCATCTCCCCCGGTGCTAGTGT 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1143497685 17:7321727-7321749 GTGTGGTCAGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1143497678_1143497686 -3 Left 1143497678 17:7321708-7321730 CCCATCTCCCCCGGTGCTAGTGT 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1143497686 17:7321728-7321750 TGTGGTCAGCCCCAGCCGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143497678 Original CRISPR ACACTAGCACCGGGGGAGAT GGG (reversed) Exonic
900558465 1:3291739-3291761 ACCCCAGCACTGGGGGAGACGGG + Intronic
902135132 1:14298504-14298526 ACACTTGCATGGGGGGAGGTAGG - Intergenic
906250117 1:44304734-44304756 ACACTATCACTGTTGGAGATGGG - Intronic
920516634 1:206589318-206589340 ACACTGGGAGCGGGGGAGAGAGG + Intronic
1063954998 10:11257516-11257538 GCACAAGCACACGGGGAGATGGG + Intronic
1064991878 10:21263555-21263577 AAACTAACCCCCGGGGAGATAGG - Intergenic
1075037773 10:119083553-119083575 ACACTAGAAACTTGGGAGATAGG + Intergenic
1101419324 12:104536782-104536804 ATACAACCACCAGGGGAGATGGG - Intronic
1115812224 14:37121966-37121988 AGACTATCATCAGGGGAGATGGG - Intronic
1118218001 14:63827744-63827766 ACACTCTCACAGGGGGAGAGCGG + Intergenic
1124626244 15:31309045-31309067 CCGCCAGCACTGGGGGAGATGGG - Intergenic
1126687689 15:51262620-51262642 ACCCTAGCACTGGGGGAGTGAGG - Intronic
1129363845 15:75042396-75042418 ACACTAGCACTTTGGGAGACTGG + Intronic
1131979306 15:97979881-97979903 GCACTAGAACTGGGGGAGATGGG - Intergenic
1138033456 16:53579590-53579612 ACAATAGAACCGAAGGAGATGGG - Intergenic
1141643300 16:85354173-85354195 GGAATACCACCGGGGGAGATGGG - Intergenic
1143497678 17:7321708-7321730 ACACTAGCACCGGGGGAGATGGG - Exonic
1143713667 17:8752214-8752236 ACACTGGGCCCAGGGGAGATGGG - Intergenic
1149613941 17:57982063-57982085 AGACTTGCACCGGGGGAGGGAGG - Intronic
1150759970 17:67952855-67952877 AGACTAGCACAGGGGGAAAGAGG - Intronic
1159523686 18:69559984-69560006 ATACTAGCACCTTGGGAGTTAGG + Intronic
1160362520 18:78296112-78296134 ACACTGGCGACGGGGAAGATGGG - Intergenic
1160603978 18:80035193-80035215 ACGCTAACACAGGGGGAGCTGGG - Intronic
1166569110 19:43782476-43782498 ACACCAGCATCGGGGGAGGGGGG + Intergenic
1168320681 19:55507823-55507845 ACGGTGGCAGCGGGGGAGATGGG + Intronic
925381091 2:3426764-3426786 AGACTTGCTCCGGGGGAGAGAGG - Intronic
932811838 2:74832848-74832870 ACATTAGCACTGGTGGAGAATGG - Intergenic
933919609 2:87031775-87031797 ACACTATCACCGTGGGAGGAAGG + Intergenic
933927998 2:87118494-87118516 ACACTATCACCGCGGGAGGAAGG + Intergenic
933932020 2:87162027-87162049 ACACTATCACCGCGGGAGGAAGG - Intergenic
934003385 2:87738124-87738146 ACACTATCACCGTGGGAGGAAGG - Intergenic
936361097 2:111803407-111803429 ACACTATCACCGCGGGAGGAAGG + Intronic
941854115 2:170212778-170212800 ACACGAGCACTGGGGGAAATGGG - Intronic
944071661 2:195676652-195676674 GAACTAGCACAGGGGTAGATAGG - Intronic
947379572 2:229532334-229532356 AAACTGGCACCTGGGGAGGTGGG - Intronic
948443484 2:238013463-238013485 ATTCTAGTACAGGGGGAGATGGG + Intronic
1169219314 20:3812228-3812250 ACAAGAGGACCGGGGGAGACAGG + Intergenic
1172962610 20:38809150-38809172 ACCCTAGCACTGGAGGAGGTGGG - Intronic
1174188570 20:48723775-48723797 ACTCTGGCCCCTGGGGAGATGGG + Intronic
1175041724 20:56058424-56058446 ACAATATCACCAGGGGACATTGG + Intergenic
1176039523 20:63056849-63056871 ACAGTAGCACTGGGGGCGGTGGG - Intergenic
1181092244 22:20481854-20481876 ACCCTAGCACCTTGGGAGACTGG - Intronic
951656807 3:25018113-25018135 ACACTTGCACAGAGGTAGATTGG + Intergenic
964132251 3:153302654-153302676 ACACCAGCCCCGGGGCAGAGAGG + Intergenic
969444052 4:7234071-7234093 ACTCCAGCACCTGGGGAGATGGG - Intronic
972262416 4:37423326-37423348 ACTCTAATACAGGGGGAGATGGG - Intronic
974085443 4:57255724-57255746 ACACTTGCCCAGGGGCAGATGGG + Intergenic
976904699 4:90222851-90222873 ATATTAGCACTGGGGGAAATTGG - Intronic
985542567 5:493708-493730 ACACCAGCCCCGGGAGGGATCGG + Intronic
1009509171 6:64526320-64526342 ACATTACCACCTGGGGAAATTGG + Intronic
1014915939 6:127148272-127148294 GAACTAGCACCCTGGGAGATTGG - Intronic
1017019314 6:150127642-150127664 ACAGTAGCACCTGGGGACACAGG - Intergenic
1026200639 7:68211645-68211667 AGTCTAGCACCAGGGGAGAAGGG - Intergenic
1026736722 7:72953668-72953690 ACACTAGCACCTGGGGATGAGGG + Intergenic
1027107012 7:75411395-75411417 ACACTAGCACCTGGGGATGAGGG - Intergenic
1030880613 7:114873949-114873971 ACAATAACACTGGGGGAGAAGGG - Intergenic
1030980816 7:116183341-116183363 ACAAGAGCACAGGGAGAGATTGG - Intergenic
1038347430 8:26745212-26745234 ACACAGGCACCCAGGGAGATAGG + Intergenic
1040368752 8:46747177-46747199 ACGCTAGCAGCGGGTGAGCTGGG + Intergenic
1048927855 8:139286772-139286794 ACTCTAGAGCCGGGAGAGATTGG - Intergenic
1053417107 9:37953679-37953701 ACCCTAGCACAGAGGGAGGTAGG - Intronic
1055109264 9:72543344-72543366 AGACTAGTAGCAGGGGAGATGGG - Intronic
1056254743 9:84787406-84787428 ACTCTAGACCCGGGGGACATGGG + Intronic
1056953881 9:91067111-91067133 ACACCAGCTCTGGGGCAGATGGG + Intergenic
1186210007 X:7240778-7240800 AGACTAGCACAGGGGCAGGTGGG - Intronic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1201278692 Y:12321910-12321932 GCACTGGCACCGTGGGAGAGAGG + Intergenic