ID: 1143499480

View in Genome Browser
Species Human (GRCh38)
Location 17:7330426-7330448
Sequence GCTGAGAGCAGCCCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143499471_1143499480 19 Left 1143499471 17:7330384-7330406 CCAGGGGCGGGGCTACGTGGAGC No data
Right 1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG No data
1143499478_1143499480 -3 Left 1143499478 17:7330406-7330428 CCGGGAGGCGGGTCAGGATCGCT No data
Right 1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143499480 Original CRISPR GCTGAGAGCAGCCCCCCAGT GGG Intergenic
No off target data available for this crispr