ID: 1143504675

View in Genome Browser
Species Human (GRCh38)
Location 17:7356992-7357014
Sequence TGCCCCCGCTTTCCCGGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143504675_1143504683 19 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504683 17:7357034-7357056 CAGGCCCTCCTATGACTGATGGG 0: 1
1: 0
2: 1
3: 6
4: 104
1143504675_1143504677 0 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504677 17:7357015-7357037 TCTGCCCCAGAAGCTATTCCAGG 0: 1
1: 0
2: 3
3: 15
4: 230
1143504675_1143504684 20 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504684 17:7357035-7357057 AGGCCCTCCTATGACTGATGGGG 0: 1
1: 0
2: 0
3: 20
4: 209
1143504675_1143504682 18 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504682 17:7357033-7357055 CCAGGCCCTCCTATGACTGATGG 0: 1
1: 0
2: 1
3: 13
4: 163
1143504675_1143504689 28 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504689 17:7357043-7357065 CTATGACTGATGGGGAATCCGGG 0: 1
1: 0
2: 1
3: 7
4: 121
1143504675_1143504688 27 Left 1143504675 17:7356992-7357014 CCTGTTCCGGGAAAGCGGGGGCA 0: 1
1: 0
2: 3
3: 3
4: 56
Right 1143504688 17:7357042-7357064 CCTATGACTGATGGGGAATCCGG 0: 1
1: 0
2: 1
3: 11
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143504675 Original CRISPR TGCCCCCGCTTTCCCGGAAC AGG (reversed) Exonic
905023180 1:34831933-34831955 TTTCCCCTCTTTCCCGGAAGGGG - Intronic
906211965 1:44017046-44017068 GGCCCCCTCTTCCCCAGAACAGG - Exonic
914203352 1:145505783-145505805 TGGCCCCGATTTCCCGGAACTGG - Intergenic
914237279 1:145823705-145823727 TGGCCCCGATTTCCCGGAACTGG - Intronic
914482474 1:148078937-148078959 TGGCCCCGATTTCCCGGAACTGG - Intergenic
921220482 1:212970182-212970204 TGCTCCCGCTTCCCTGGAAAAGG + Intronic
1064712327 10:18140431-18140453 TGCGCCCGCTCTCCCGGCCCCGG + Intergenic
1066450201 10:35521733-35521755 TGCCCCTGCTTTCCAGGGGCCGG + Intronic
1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG + Intronic
1072418411 10:95268937-95268959 TGCCCCCTCTTTCCTGGACTAGG + Intronic
1074789157 10:116868871-116868893 TGCCCCTGCCTTCCAGCAACAGG + Intronic
1074919531 10:117993260-117993282 TGCCCTCTATTTCCCTGAACTGG - Intergenic
1077355512 11:2115010-2115032 TGCCCCGGCATTCCCAGGACAGG + Intergenic
1081973320 11:47214913-47214935 CGCCCCCGCCTTCCAGGAAGGGG + Intronic
1082166400 11:48955592-48955614 TGCCCCCCACTTCCCGGAAGGGG + Intergenic
1082772520 11:57219491-57219513 TGCTCTGGCTTTCCCGGAACAGG + Intergenic
1091991192 12:4957267-4957289 TGCCCCGGCTCTCCCGGGCCAGG - Intergenic
1097165978 12:57087157-57087179 CTCCCCCTCTTTCCCGGATCAGG + Intronic
1102454154 12:113061187-113061209 TGCCCCCTGTTTGCCGGAAAAGG + Intronic
1104062800 12:125282299-125282321 TGCCCCCGCCTTCCCCGGCCTGG + Intronic
1107840412 13:44451409-44451431 TGCCCACTCTTTCCCTGAAAAGG - Intronic
1122028931 14:98898624-98898646 AGCCCCCGCCGTCCAGGAACTGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1131423547 15:92326887-92326909 GGCCCCTGCCTTCCTGGAACAGG + Intergenic
1131483513 15:92801735-92801757 TGCCCCAGCTTTCGGGGCACAGG + Intronic
1133219804 16:4315350-4315372 TGCCTGCGCGTTCCTGGAACTGG + Exonic
1142299142 16:89246676-89246698 TGCCCCCGCCCTCCCCCAACAGG - Intergenic
1142891643 17:2947795-2947817 TTCCCCAGCTTTCCAGAAACGGG + Intronic
1142980459 17:3668336-3668358 GGTCCCCGCTTTGCCGGAGCGGG - Intronic
1143504675 17:7356992-7357014 TGCCCCCGCTTTCCCGGAACAGG - Exonic
1146724823 17:35148388-35148410 TGGCCACGCTTTATCGGAACCGG + Exonic
1148323632 17:46771478-46771500 CGCCCCCGCGTTCCCGGGGCTGG - Intronic
1153765133 18:8367511-8367533 TGGCCGCGCTTCCGCGGAACAGG - Intronic
1157095174 18:44680457-44680479 GGCCCCCGCACTCCCGGAACCGG + Intronic
1166561116 19:43732996-43733018 TGCCCCAACTTTCCAGGACCTGG - Exonic
928084208 2:28335617-28335639 TGCTCCCGCTTTCCAGGGGCTGG + Intronic
928408366 2:31032671-31032693 TACCCCCTCTTTCCCAGCACAGG + Intronic
931649250 2:64454040-64454062 GGCCCCCGCCCTCCCGGACCCGG + Intronic
938501532 2:131833331-131833353 TGCTCCCGCTTCCCCGGCCCAGG - Intergenic
938554895 2:132415964-132415986 TGCAGCCGCTTTCCCGGCAGCGG - Intergenic
939034573 2:137115302-137115324 TGCACCATCTGTCCCGGAACTGG - Intronic
948869041 2:240789200-240789222 TGCCCCCGCCTCCCCCGACCCGG + Intronic
1185384481 22:50525548-50525570 GGCGCCCGCTTTCCCTGAGCCGG - Intronic
968606552 4:1538243-1538265 AGCCCCTCCTTTCCCGGCACTGG - Intergenic
971217292 4:24673175-24673197 TGCACACGCATTCCCGGAGCTGG - Intergenic
985558203 5:568467-568489 TGCCCCCGCATCCCCGTGACAGG + Intergenic
994182763 5:96785435-96785457 TGGCCCCGCTATACCGGATCAGG - Intronic
997981151 5:138467955-138467977 TCCCCCTGCTTTCCCGGCCCAGG + Exonic
1003427821 6:6009008-6009030 CGGCCCAGCTTTCCCGGACCAGG + Intergenic
1006357446 6:33568262-33568284 TGCCCCCTCTTGCCAGGAAAAGG + Intergenic
1016040122 6:139424125-139424147 AACCACCACTTTCCCGGAACTGG - Intergenic
1020560933 7:9728106-9728128 TGCCCAGGTTTTCCAGGAACTGG + Intergenic
1024214082 7:47232086-47232108 TGCCTCCCCACTCCCGGAACTGG + Intergenic
1026090643 7:67297786-67297808 TGCCCCCGCTTTCTCCTTACTGG - Intergenic
1034425969 7:151014190-151014212 GGCAGCCGCTCTCCCGGAACTGG - Exonic
1035456112 7:159010033-159010055 TGCCCCCGCTTTGCGGGAGCGGG + Intergenic
1036707565 8:11056580-11056602 GACCCCAGCTTCCCCGGAACTGG + Intronic
1039898045 8:41730210-41730232 TGACCCCGCTTCCCCGGGTCAGG + Intronic
1047346278 8:124031779-124031801 TGCCCCTGCCTTCCCTCAACTGG - Intronic
1048881779 8:138877633-138877655 TTCCCCCGCCTTCCTGGAGCCGG + Intronic
1049783558 8:144439875-144439897 GGCCAGTGCTTTCCCGGAACTGG - Intronic
1057466246 9:95317254-95317276 CGCCCCCGCTTTCCCCGCCCTGG + Intronic
1192212634 X:69137387-69137409 TTCCCCCACTTTCCCCAAACGGG + Intergenic