ID: 1143510973

View in Genome Browser
Species Human (GRCh38)
Location 17:7394773-7394795
Sequence CACGCACGCCGCCGGCCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143510973_1143510989 29 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510989 17:7394825-7394847 GCCCGGGCCGCGCTGGCCCCTGG 0: 1
1: 0
2: 3
3: 74
4: 465
1143510973_1143510988 22 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510988 17:7394818-7394840 GAGGGCGGCCCGGGCCGCGCTGG 0: 1
1: 2
2: 5
3: 75
4: 604
1143510973_1143510977 -9 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510977 17:7394787-7394809 GCGTGCGTGCTCAGCGCCCTGGG 0: 1
1: 0
2: 1
3: 2
4: 51
1143510973_1143510980 -2 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510980 17:7394794-7394816 TGCTCAGCGCCCTGGGTGGGAGG 0: 1
1: 1
2: 4
3: 30
4: 280
1143510973_1143510987 13 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510987 17:7394809-7394831 GTGGGAGGCGAGGGCGGCCCGGG 0: 1
1: 1
2: 0
3: 51
4: 582
1143510973_1143510981 3 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510981 17:7394799-7394821 AGCGCCCTGGGTGGGAGGCGAGG 0: 1
1: 0
2: 3
3: 46
4: 391
1143510973_1143510978 -6 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510978 17:7394790-7394812 TGCGTGCTCAGCGCCCTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 141
1143510973_1143510991 30 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510991 17:7394826-7394848 CCCGGGCCGCGCTGGCCCCTGGG 0: 1
1: 0
2: 1
3: 34
4: 293
1143510973_1143510982 4 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510982 17:7394800-7394822 GCGCCCTGGGTGGGAGGCGAGGG 0: 1
1: 0
2: 1
3: 28
4: 312
1143510973_1143510979 -5 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510979 17:7394791-7394813 GCGTGCTCAGCGCCCTGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 123
1143510973_1143510984 7 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510984 17:7394803-7394825 CCCTGGGTGGGAGGCGAGGGCGG 0: 1
1: 0
2: 3
3: 82
4: 767
1143510973_1143510986 12 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510986 17:7394808-7394830 GGTGGGAGGCGAGGGCGGCCCGG 0: 1
1: 0
2: 6
3: 75
4: 801
1143510973_1143510976 -10 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510976 17:7394786-7394808 GGCGTGCGTGCTCAGCGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143510973 Original CRISPR CACGCACGCCGCCGGCCTGG CGG (reversed) Exonic