ID: 1143510973

View in Genome Browser
Species Human (GRCh38)
Location 17:7394773-7394795
Sequence CACGCACGCCGCCGGCCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143510973_1143510977 -9 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510977 17:7394787-7394809 GCGTGCGTGCTCAGCGCCCTGGG 0: 1
1: 0
2: 1
3: 2
4: 51
1143510973_1143510991 30 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510991 17:7394826-7394848 CCCGGGCCGCGCTGGCCCCTGGG 0: 1
1: 0
2: 1
3: 34
4: 293
1143510973_1143510979 -5 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510979 17:7394791-7394813 GCGTGCTCAGCGCCCTGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 123
1143510973_1143510976 -10 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510976 17:7394786-7394808 GGCGTGCGTGCTCAGCGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 79
1143510973_1143510989 29 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510989 17:7394825-7394847 GCCCGGGCCGCGCTGGCCCCTGG 0: 1
1: 0
2: 3
3: 74
4: 465
1143510973_1143510984 7 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510984 17:7394803-7394825 CCCTGGGTGGGAGGCGAGGGCGG 0: 1
1: 0
2: 3
3: 82
4: 767
1143510973_1143510978 -6 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510978 17:7394790-7394812 TGCGTGCTCAGCGCCCTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 141
1143510973_1143510980 -2 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510980 17:7394794-7394816 TGCTCAGCGCCCTGGGTGGGAGG 0: 1
1: 1
2: 4
3: 30
4: 280
1143510973_1143510987 13 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510987 17:7394809-7394831 GTGGGAGGCGAGGGCGGCCCGGG 0: 1
1: 1
2: 0
3: 51
4: 582
1143510973_1143510986 12 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510986 17:7394808-7394830 GGTGGGAGGCGAGGGCGGCCCGG 0: 1
1: 0
2: 6
3: 75
4: 801
1143510973_1143510988 22 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510988 17:7394818-7394840 GAGGGCGGCCCGGGCCGCGCTGG 0: 1
1: 2
2: 5
3: 75
4: 604
1143510973_1143510981 3 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510981 17:7394799-7394821 AGCGCCCTGGGTGGGAGGCGAGG 0: 1
1: 0
2: 3
3: 46
4: 391
1143510973_1143510982 4 Left 1143510973 17:7394773-7394795 CCGCCAGGCCGGCGGCGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1143510982 17:7394800-7394822 GCGCCCTGGGTGGGAGGCGAGGG 0: 1
1: 0
2: 1
3: 28
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143510973 Original CRISPR CACGCACGCCGCCGGCCTGG CGG (reversed) Exonic
900019985 1:181560-181582 GTCGCACGGCGCCGGGCTGGGGG + Intergenic
900237442 1:1599503-1599525 CACGCACTCGGCCGGCTCGGGGG + Exonic
902214171 1:14924223-14924245 GGCGCGCGCCGCCGGCCGGGCGG + Intronic
921944445 1:220877245-220877267 CACTCCAGCCGCGGGCCTGGCGG + Intergenic
923171778 1:231422670-231422692 CACACCCCGCGCCGGCCTGGAGG - Exonic
1065660265 10:27998877-27998899 CGCGCACGCCGGCGCCCTTGTGG + Intronic
1076522237 10:131088613-131088635 CACGAGTGCCCCCGGCCTGGAGG - Intergenic
1079630298 11:22666761-22666783 CCCGCACCCCACCAGCCTGGCGG - Exonic
1083299080 11:61730881-61730903 CACACACGCCGCCCAGCTGGAGG + Intronic
1085096020 11:73761125-73761147 CACGCACGCCAGCGGCCGGCGGG - Exonic
1089104419 11:115990304-115990326 CACGCACGCCGGCGCTCTGCTGG + Intergenic
1089671282 11:120058618-120058640 CACGCATGCTGCAGACCTGGGGG + Intergenic
1091154521 11:133361145-133361167 CACGGACAGCGCCGGCTTGGTGG - Intronic
1091373365 12:11174-11196 GTCGCACGGCGCCGGGCTGGGGG + Intergenic
1091558734 12:1594603-1594625 CCCGCACTCCGCCGCCCAGGCGG + Intronic
1103703275 12:122858833-122858855 CACAGACGCCTCCGCCCTGGTGG + Exonic
1103722238 12:122981073-122981095 CCCGCCCGCGGCCGGCCTTGGGG + Exonic
1104927021 12:132319076-132319098 CACGCACGCTGCAGGCTTGGTGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1120067168 14:80056239-80056261 CACACACACCCCAGGCCTGGGGG - Intergenic
1127515455 15:59689171-59689193 GCCCCACGTCGCCGGCCTGGAGG - Exonic
1128582274 15:68818519-68818541 CACGCCTGCCCCCTGCCTGGAGG - Intronic
1132055971 15:98650162-98650184 CTCGCACCCCGCGGGCCGGGCGG - Intronic
1132453664 16:10725-10747 GTCGCACGGCGCCGGCCTGGGGG + Intergenic
1132503821 16:297025-297047 CCCGCACGCAGCCAGCCTCGTGG - Intronic
1132560787 16:592667-592689 CACGCACGCCGCCAGCCTCCTGG - Intronic
1132785477 16:1654937-1654959 CACCCACGCCCACGCCCTGGCGG + Intronic
1133304931 16:4802715-4802737 CGAGCACGGAGCCGGCCTGGGGG - Exonic
1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG + Exonic
1140078582 16:71723785-71723807 CCCGCGAGCCGCCGGCCGGGAGG - Intronic
1141520085 16:84572783-84572805 CACCCACGCTGCCAGGCTGGAGG + Intronic
1141731438 16:85825536-85825558 CACGCCCACCCCTGGCCTGGGGG - Intergenic
1141784794 16:86191869-86191891 CGAGCACGCCGCTGGGCTGGAGG + Intergenic
1141840085 16:86568451-86568473 CAACCTCGCCGCCGGCCAGGAGG + Exonic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1143868535 17:9941417-9941439 GACGCACGCTGTCGTCCTGGAGG - Intronic
1149678525 17:58487845-58487867 CAAGCTGGCGGCCGGCCTGGAGG - Exonic
1152079002 17:78175009-78175031 CCCCCACCCCGCCGGCCTGCAGG + Intronic
1152568289 17:81109933-81109955 CACCCACGCCCCCCACCTGGGGG + Intronic
1152898648 17:82927819-82927841 CACACAGGCTGCCGGCGTGGTGG + Intronic
1154072319 18:11163848-11163870 CAGGCACGCCGCGGGCCCAGCGG + Intergenic
1160900455 19:1425410-1425432 CACGCGGGCCCCCGGCCTGCAGG + Intronic
1160999973 19:1905641-1905663 CGCGCGCGGCGCTGGCCTGGGGG + Intronic
1161770988 19:6230563-6230585 CACTCACCCCGCCGGCCCGCAGG + Exonic
1162410770 19:10503571-10503593 AACGCACAGCGCCGGCCTCGTGG + Exonic
1162926173 19:13931539-13931561 CACAGACCACGCCGGCCTGGCGG - Intronic
1163248405 19:16111491-16111513 CTCGCGCGCCGGCAGCCTGGCGG - Intergenic
1165427870 19:35755716-35755738 TACGCTCGCCGCCGGGCCGGAGG - Intronic
1167045382 19:47046187-47046209 CTCGTACGCCGTGGGCCTGGCGG - Exonic
1168642234 19:58038154-58038176 CAGGGAGGCCGCCAGCCTGGTGG + Exonic
925162232 2:1693897-1693919 CACGGAGGCCACGGGCCTGGGGG + Intronic
938406274 2:131034953-131034975 CGCGCACGGCGCCGGCTTCGCGG + Intronic
948836912 2:240630338-240630360 CACGGCCGCAGCCTGCCTGGGGG - Exonic
1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG + Intronic
1176194404 20:63830838-63830860 GCCCCGCGCCGCCGGCCTGGGGG + Intronic
1179929580 21:44558409-44558431 CAGGCACGCAGCAGGCCTGCTGG + Exonic
1179942106 21:44647010-44647032 CAGGCACGCAGCAGGCCTGCTGG - Exonic
1181050923 22:20237853-20237875 CCCCCACGTTGCCGGCCTGGTGG - Intergenic
954697283 3:52434655-52434677 CAAGCATGCCGCAGCCCTGGAGG - Exonic
967930680 3:194688053-194688075 CACTGGCGCCGTCGGCCTGGCGG - Exonic
972321589 4:37977437-37977459 CACTCCCGCCGCCGGCCCGTGGG - Intronic
985467718 5:13047-13069 CACGCACGTCGCTGGGCTGAGGG + Intergenic
999239606 5:150119934-150119956 CACTCATGCCTCTGGCCTGGTGG - Intronic
1002000647 5:176194752-176194774 CGCGCACGGCGCTCGCCTGGCGG - Intergenic
1002253692 5:177944229-177944251 CGCGCACGGCGCTCGCCTGGCGG + Intergenic
1002347154 5:178555964-178555986 CAGGCACGCTGCAGGCCTGAGGG - Intronic
1003114192 6:3272622-3272644 CACGCAGGCAGGCAGCCTGGGGG + Exonic
1003881328 6:10482702-10482724 GGCGCACACCGCCGGACTGGAGG - Intergenic
1004516649 6:16327122-16327144 CACGCCCGCAGCTGACCTGGAGG - Exonic
1018156723 6:160991979-160992001 CACGCCTGCCGCCGCCATGGAGG + Exonic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1023382678 7:39623867-39623889 CACCCCCGCCGCCGCCCGGGTGG - Intronic
1027232586 7:76281490-76281512 CACCCACGCCGCCCGCGCGGGGG + Exonic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1029474760 7:100776433-100776455 CACACATGCCGCAGACCTGGCGG - Exonic
1030033439 7:105388882-105388904 CACTCGCTCCGCCGGCCGGGAGG + Exonic
1034335796 7:150322974-150322996 CACGCACAGCGCCGGCGTGCAGG + Intronic
1034781894 7:153888336-153888358 CAGGCACGCGGCCCTCCTGGGGG - Intronic
1035129766 7:156640853-156640875 CATGGACCCCGCCCGCCTGGCGG - Exonic
1048968954 8:139633809-139633831 CACGCTCGCAGCAGGCCTCGGGG - Intronic
1049740500 8:144238785-144238807 CCCGCACGCTGTCGGCCTTGGGG - Exonic
1049843759 8:144790004-144790026 CACCCCCGCCCCCGGCCTCGGGG + Intronic
1049883073 9:11148-11170 GTCGCACGGCGCCGGGCTGGGGG + Intergenic
1057995900 9:99821626-99821648 CACGGCCGGCCCCGGCCTGGGGG - Intergenic
1061011988 9:127961271-127961293 CATGCATGCCACCTGCCTGGGGG - Intronic
1197199009 X:123732827-123732849 CACGCCCGCCGCCCGGGTGGGGG + Intronic
1200402728 X:156028993-156029015 GTCGCACGGCGCCGGGCTGGGGG - Intergenic