ID: 1143512294

View in Genome Browser
Species Human (GRCh38)
Location 17:7403582-7403604
Sequence TCTGGGGTCCCTGGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 8, 3: 87, 4: 655}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143512294_1143512303 7 Left 1143512294 17:7403582-7403604 CCACTTCCCCCAGGGACCCCAGA 0: 1
1: 0
2: 8
3: 87
4: 655
Right 1143512303 17:7403612-7403634 CCTTCGTAGACCCACGAGTCAGG 0: 1
1: 0
2: 0
3: 0
4: 20
1143512294_1143512304 8 Left 1143512294 17:7403582-7403604 CCACTTCCCCCAGGGACCCCAGA 0: 1
1: 0
2: 8
3: 87
4: 655
Right 1143512304 17:7403613-7403635 CTTCGTAGACCCACGAGTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143512294 Original CRISPR TCTGGGGTCCCTGGGGGAAG TGG (reversed) Intronic
900192052 1:1356018-1356040 TCTGAGGACCCTGGTGGAGGAGG + Intronic
900340406 1:2186093-2186115 TCTGAGCTCCCTGGGAGAGGGGG + Intronic
900479083 1:2889627-2889649 TCTGGGGGCCCCGCTGGAAGAGG + Intergenic
900685428 1:3945068-3945090 TCTGGAGTCCCTGGGGGGATGGG + Intergenic
900799133 1:4726825-4726847 TTCAGGGTCCCTGGGGGATGGGG + Intronic
900908969 1:5580602-5580624 TCTGGGGTCCTGGAAGGAAGAGG - Intergenic
900947855 1:5841287-5841309 TGTGGGGACCGTGGGGGCAGGGG - Intergenic
901022292 1:6261397-6261419 TCTGGGGGCCCGGGGGCCAGAGG + Intergenic
901426113 1:9183075-9183097 TCTCGGGTCCCGGGGGGCTGGGG + Intergenic
901459700 1:9384269-9384291 TCTGGGCTCCATGGGGGAGCTGG - Intergenic
901477139 1:9497474-9497496 TCTGTGGTCCCTGGGTGTGGTGG - Intergenic
901685561 1:10941717-10941739 TTAGTGGTCACTGGGGGAAGGGG - Intergenic
901847113 1:11990470-11990492 TCTGGGCTCCCAGAGGGGAGCGG - Intronic
902174334 1:14638092-14638114 ACTGGTGTCCCTGTGAGAAGAGG - Intronic
902193234 1:14778505-14778527 TCTGGGTTCCCTTGGCCAAGTGG + Intronic
902323509 1:15684113-15684135 TCTGGCGTCCCTGGGGTCTGAGG + Intergenic
902334744 1:15748412-15748434 GCTGGGTCCCCTGGGGGACGTGG + Intergenic
902372700 1:16016049-16016071 TCTGGGGCTCCTGGGGAACGTGG + Intronic
902919256 1:19656718-19656740 TCTGGGGTCCCATGGGGAGGGGG - Intronic
902923555 1:19681078-19681100 TCTGGGGTCCCAGATTGAAGGGG - Intergenic
903176089 1:21581778-21581800 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
903287256 1:22285027-22285049 TCAGGAGCTCCTGGGGGAAGGGG - Intergenic
903438747 1:23371296-23371318 TCTGGAGCCCCTGGGGGGAGTGG + Exonic
903664230 1:24996721-24996743 TGTGGGGTCCCTGAGGGCAGGGG + Intergenic
903774007 1:25781499-25781521 GCTGGGCTGCCTGTGGGAAGAGG - Intronic
904276134 1:29385510-29385532 TCTGGGGTCCCTGGGCCAAGAGG - Intergenic
904778271 1:32925117-32925139 GCGGGGGTCCCTGGGGGAGGGGG + Intergenic
904814300 1:33183477-33183499 CCTTGGGTCACTTGGGGAAGGGG - Intergenic
905208061 1:36354229-36354251 CCTGGGATTCCTGGAGGAAGTGG + Intronic
905334986 1:37238958-37238980 TCTGGGCCCTCTGGGGGAGGGGG + Intergenic
905394279 1:37657252-37657274 ACTGGGGTCCCTGAGGGCTGGGG - Intergenic
905797942 1:40826013-40826035 CCTGGGGTCCCTGGGAGAAAGGG - Intronic
905866452 1:41379590-41379612 TCTGGAGACCCTGAGGGGAGGGG - Intronic
905880020 1:41457339-41457361 TCCGGGTGCCCTGGGGGATGGGG + Intergenic
905908940 1:41640616-41640638 TTTGGGCTCCCTGGGAGAAAGGG - Intronic
906143266 1:43546017-43546039 GCCAAGGTCCCTGGGGGAAGGGG + Intronic
906239992 1:44236961-44236983 CCTGGAGTCCCTGGAGGAGGTGG - Intronic
906640559 1:47438387-47438409 TCTGGCGTCCCGGGGGGCGGCGG + Exonic
907045280 1:51296789-51296811 TCTGGGGTCCCAGGAAGCAGAGG - Intronic
907842739 1:58172760-58172782 GCACTGGTCCCTGGGGGAAGAGG - Intronic
908659430 1:66421255-66421277 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
908680853 1:66659448-66659470 TCTGGGTTCCCTGGAGAAACTGG + Intronic
909720849 1:78767623-78767645 GATGGGGCCCCTGGGGAAAGGGG + Intergenic
910680896 1:89863319-89863341 TCTGTGGCCCCTGGAGGAAGAGG + Intronic
910713287 1:90203826-90203848 GCTGGGGTTCCTGTGGGAACTGG + Intergenic
910979343 1:92943655-92943677 TCTGGGGTCCCTCGTGCCAGCGG - Intronic
911116057 1:94247650-94247672 TCTGCGGGCCGTGGGGGATGGGG - Intronic
911129403 1:94373687-94373709 GCACTGGTCCCTGGGGGAAGCGG + Intergenic
911171987 1:94780020-94780042 TATAGGGTCCCTGGGGAAGGTGG - Intergenic
911954126 1:104214613-104214635 TCTGTGGTGCCTGGGGCCAGGGG + Intergenic
912858072 1:113189537-113189559 TTTGGGGACAGTGGGGGAAGGGG - Intergenic
913092401 1:115486468-115486490 TGTGGGGTTGTTGGGGGAAGAGG + Intergenic
913195041 1:116449235-116449257 CCTGGGGTACCTGCAGGAAGTGG - Intergenic
914048322 1:144108497-144108519 TCCGGGGCCCCTGTGGAAAGAGG - Intergenic
914130862 1:144856951-144856973 TCCGGGGCCCCTGTGGAAAGAGG + Intergenic
915150572 1:153827505-153827527 TATGGGGGAGCTGGGGGAAGTGG + Intronic
915260967 1:154676607-154676629 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
915275754 1:154787242-154787264 CCTAGGCTCCCTGTGGGAAGTGG + Intronic
915579102 1:156802807-156802829 TCAGTGGGGCCTGGGGGAAGTGG + Intergenic
915624332 1:157105659-157105681 TCTTGGGTCCCTGGGGGCCGTGG + Intergenic
915974262 1:160374842-160374864 TCAGGGATCCCTGAGGGGAGGGG - Intergenic
916084053 1:161255527-161255549 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
916114829 1:161477700-161477722 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
917473191 1:175343449-175343471 TCTGGGATCGGTGGAGGAAGTGG + Intronic
918248897 1:182684486-182684508 TCTAGGGGCGCTGGGTGAAGTGG - Intronic
918450059 1:184649373-184649395 TCTCTGGACCCTGGGAGAAGAGG + Intergenic
918749931 1:188259538-188259560 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
919257167 1:195139900-195139922 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
919262630 1:195217516-195217538 TCTGTGGTCGTTGGGTGAAGTGG - Intergenic
920105732 1:203552070-203552092 TCTGGGGTCACCTGGGCAAGAGG + Intergenic
920196728 1:204232793-204232815 TCTGTGGTCCCAGAGGGCAGGGG + Intronic
920306981 1:205024918-205024940 TTTGGGGTACTTGTGGGAAGCGG - Intergenic
920505712 1:206513836-206513858 GCTGGGTTCCCTGGGGGCACTGG + Intronic
920531748 1:206707231-206707253 TCTGGAGTGCCTGGGGGTGGGGG - Intronic
920541570 1:206782724-206782746 CCTGGGGCCCCTTGGAGAAGGGG - Intergenic
922192894 1:223334877-223334899 TTTGGGGACCCAGGGGGAAAGGG - Intronic
922545046 1:226450424-226450446 TCTGGGGTTCCTTGGCCAAGAGG - Intergenic
922819039 1:228471317-228471339 TCTTGGGTTCCTGCGCGAAGGGG - Intergenic
923000912 1:230005689-230005711 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
923783698 1:237048048-237048070 TCTGGGGTCCGAGAGGCAAGAGG - Intronic
924009057 1:239644367-239644389 GCTGAGGACCCTGGGGGAACAGG - Intronic
924245448 1:242079360-242079382 TCTGAGGTCCCTGAGAGGAGGGG + Intergenic
1063156984 10:3389011-3389033 TCTGGGGTGGGTGGGGGATGAGG + Intergenic
1063309750 10:4941015-4941037 CTTGGGGTCTCTGGGGGAGGTGG + Intronic
1063317541 10:5021086-5021108 TTTGGGGTCTCTGGGGGAGGTGG - Intronic
1063321317 10:5055119-5055141 GCACTGGTCCCTGGGGGAAGAGG + Intronic
1063519005 10:6724005-6724027 TCTGGGGACTTTGGGGGAACGGG + Intergenic
1063639175 10:7813929-7813951 TAAGGGGTCCCTGGGCGAAATGG + Intergenic
1064603176 10:17013765-17013787 TTGCTGGTCCCTGGGGGAAGAGG + Intronic
1065574161 10:27101523-27101545 TCTAGGGTCCCTTGTGGAGGAGG + Intergenic
1066614192 10:37279519-37279541 GCACTGGTCCCTGGGGGAAGAGG + Intronic
1067066792 10:43108567-43108589 TCTGGTGTCCCTTGGCCAAGAGG + Intronic
1067133161 10:43584562-43584584 TCTGGGGTCCCAGGGGAACAAGG + Intergenic
1067660451 10:48233248-48233270 TCTGAGGACCCTGTGGGAGGGGG + Intronic
1069115304 10:64497534-64497556 CCTGGGGTCCCTGGGGTCTGGGG + Intergenic
1069220239 10:65874334-65874356 TCTGGGGTAAGTGGGGGAAATGG - Intergenic
1069643045 10:69968602-69968624 TCTGGAGGCCTTGGGGGCAGAGG - Intergenic
1070020151 10:72577168-72577190 TCTGGGGGCTCTGGGGGGACAGG + Intronic
1070175009 10:73962757-73962779 TCTAGGCTCACTGGGGCAAGTGG + Intergenic
1070195259 10:74151053-74151075 TCTGGGGTCCCTCATGGTAGGGG + Exonic
1070497167 10:77035008-77035030 TCTGCCCTCCCTGGGGGTAGGGG + Intronic
1071197294 10:83175944-83175966 CCTGGGGTTACTGGGGGAGGGGG + Intergenic
1071536664 10:86438622-86438644 ACTGGGGGCCCTGGGGGAATAGG + Intronic
1072623578 10:97096707-97096729 TCTGGGTTTGCTGGGGGAAGGGG - Intronic
1073102888 10:101016040-101016062 TCAGGGGGCCCTGGGGGCACTGG - Intronic
1073656580 10:105423682-105423704 ACTGGGGTGGCTGGGGAAAGAGG + Intergenic
1073889362 10:108081301-108081323 TCTGTGTTCCCTTGGGGAGGTGG - Intergenic
1074433962 10:113417935-113417957 TCTGAGGGCCATGGAGGAAGAGG + Intergenic
1074769747 10:116725483-116725505 GCTGGGGGCCCTGAGAGAAGGGG + Intronic
1075174255 10:120144603-120144625 CCTGGGGACCCTGTGGGATGGGG - Intergenic
1075222944 10:120600509-120600531 TGTGGGATCCATGGGGGCAGAGG + Intergenic
1075555817 10:123431094-123431116 TGTGGGTTCCCTGGAGCAAGAGG - Intergenic
1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG + Intronic
1076196036 10:128519035-128519057 CCTGGAGTCCCTGCGGCAAGCGG - Intergenic
1076395654 10:130136131-130136153 TCGGGGCTCCCTGGCTGAAGGGG - Intergenic
1076715317 10:132361074-132361096 TCTGGGGCCCCTGTGGAGAGGGG + Intronic
1076736305 10:132460734-132460756 TGTGGGATCCCCTGGGGAAGAGG + Intergenic
1076751479 10:132545586-132545608 TGTGGGGGCCTTAGGGGAAGAGG + Intronic
1076982285 11:210998-211020 AGTGGGGTCCCCTGGGGAAGTGG - Intronic
1077436242 11:2540514-2540536 ACTGGGGTACCTGGGGCCAGGGG + Intronic
1078329927 11:10410793-10410815 TCTGGAGTCCCTGGGGGAAAGGG + Intronic
1078582352 11:12548265-12548287 GCTGGAGTCTCTGCGGGAAGAGG + Intergenic
1079312478 11:19378845-19378867 TCTGAGCTCCCTGAGGGCAGGGG + Intronic
1079730803 11:23936456-23936478 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1080458724 11:32436072-32436094 CTTGGGGTCACTGGGGAAAGAGG + Intergenic
1081601125 11:44495133-44495155 TTTGGGCTCCTTGAGGGAAGAGG - Intergenic
1081730752 11:45370175-45370197 TCTGGGAAACCAGGGGGAAGGGG + Intergenic
1082778774 11:57269857-57269879 TCTGCGTTCCCATGGGGAAGTGG - Intergenic
1082980092 11:59113326-59113348 TGTGGGGTACCTGGGAGAATAGG + Intronic
1083162727 11:60865175-60865197 TCTGGGGGCACAGTGGGAAGAGG - Intergenic
1083171305 11:60925195-60925217 TCAGGGAGCCCTGGGGGAAGGGG - Intronic
1083365687 11:62140317-62140339 TCTGAGGGCCCTGGAGGATGTGG + Intronic
1083472791 11:62895420-62895442 TCTGGGAGCCCTGGGGGTAGAGG + Intergenic
1083590280 11:63889580-63889602 TCTGAGATCCCAGGCGGAAGGGG + Intronic
1083876446 11:65526493-65526515 CCTGAGGACCCTGGGGGCAGAGG - Intronic
1083995319 11:66268846-66268868 CCTGGGGCCCCTGGGGGGAGGGG - Intronic
1084084692 11:66849628-66849650 TCTTGGGTCCCTGCAGGAAGAGG + Exonic
1084116736 11:67046746-67046768 TCTTGGGACCATGGGGGAAGTGG + Intronic
1084211408 11:67625122-67625144 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1084269182 11:68020020-68020042 TCTGGGGACAGTGGGGGCAGAGG - Intronic
1084531311 11:69729466-69729488 CCTGGGGTCCCTGGTGGAGGAGG - Intergenic
1084951466 11:72668510-72668532 CAGGGGGTCCCTGAGGGAAGAGG + Intronic
1084966927 11:72749904-72749926 TCTGGCCTCTCTGGGGGAAAGGG - Intronic
1086053944 11:82626462-82626484 GCATTGGTCCCTGGGGGAAGAGG - Intergenic
1086317792 11:85611592-85611614 GCACTGGTCCCTGGGGGAAGAGG - Intronic
1086732289 11:90265412-90265434 ACTGGGGTCTGTGGGGGATGGGG - Intergenic
1086924332 11:92624063-92624085 TCTGAGTTCCCTGGGAGCAGAGG - Intronic
1088988302 11:114929138-114929160 TCTGGGGGTCCTGGGGGAAAGGG + Intergenic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1089699743 11:120237465-120237487 TCTGGGGTTCTGGGGGGAATGGG - Intronic
1090229638 11:125092376-125092398 TGTGGGGTGGCTGGGGGAGGAGG + Intergenic
1090420773 11:126573454-126573476 GCTGGGGTGGGTGGGGGAAGCGG - Intronic
1091206221 11:133823141-133823163 ACTGGGGACCCTGGGGTAAGTGG - Intergenic
1091664833 12:2411648-2411670 TCTGGGCTCCCTGGTGTAAAAGG - Intronic
1093345656 12:18036404-18036426 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1094499234 12:31007860-31007882 TGTGGGGTCCCTGGGGGCAAGGG - Intergenic
1096337148 12:50764760-50764782 GCTGGCGACCCTGAGGGAAGAGG + Intronic
1096457357 12:51798662-51798684 ACAGGGGTGCCTGGGGAAAGAGG + Intronic
1096587936 12:52635789-52635811 TTTGGGGACCCAGGGGGAAAGGG + Intergenic
1097346993 12:58504536-58504558 TCTGAGATCCCTGAGGGTAGGGG + Intergenic
1099376639 12:81901558-81901580 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1100477604 12:94948802-94948824 TCGGGGGCCCCTGTGTGAAGCGG - Intronic
1101331218 12:103759285-103759307 TCTGGGCTTCTTGGGGGAACGGG + Intronic
1101940766 12:109097779-109097801 GCTGGGGTGCCTGAGGAAAGCGG + Exonic
1102348727 12:112176444-112176466 TCTGGGTTCCCTGGGGTATCAGG - Intronic
1104149525 12:126069350-126069372 CCTGGGGTTCCAGGGTGAAGAGG + Intergenic
1105327666 13:19384616-19384638 TGTGGGGCTCCTGGGGGAGGTGG + Intergenic
1105705431 13:22965126-22965148 TCTGTGGTCCCTCGGGGCTGGGG + Intergenic
1105858333 13:24390111-24390133 TCTGTGGTCCCTCGGGGCTGGGG + Intergenic
1105864235 13:24445062-24445084 TGTGGGGCTCCTGGGGGAGGTGG - Intronic
1106105816 13:26732612-26732634 TCAGAGGTCCCTGGCGGAAGGGG + Intergenic
1106796934 13:33216548-33216570 TTTGGGGACTCTGGGGGAAAGGG + Intronic
1108848994 13:54705352-54705374 GGTCTGGTCCCTGGGGGAAGAGG - Intergenic
1110447637 13:75604675-75604697 TCTTGCCTCACTGGGGGAAGAGG + Intronic
1111396029 13:87671630-87671652 TTTGGGGTTTCTGGGGGAAGGGG - Intergenic
1112231022 13:97589385-97589407 ACTGGGGTGGCTGGGGAAAGAGG + Intergenic
1112244668 13:97720841-97720863 TCTGTGGTCTCCTGGGGAAGAGG + Intergenic
1112519543 13:100083391-100083413 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1112988799 13:105485680-105485702 ACTGGGGTCCTTGTTGGAAGAGG + Intronic
1113294181 13:108939328-108939350 GCTGGGGTCCCCGGGGGAAAGGG + Intronic
1113551090 13:111193660-111193682 GCACTGGTCCCTGGGGGAAGAGG + Intronic
1113711334 13:112467280-112467302 CCTGGGGCTCCTGGGGGAGGAGG - Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113890874 13:113734976-113734998 TCTGGGAGCCATGGGGGAGGGGG + Intronic
1113903588 13:113809119-113809141 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903649 13:113809343-113809365 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903703 13:113809546-113809568 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1113903713 13:113809573-113809595 TCTGTGGTTCCTGGGGGGAGGGG + Intronic
1114416921 14:22551110-22551132 ACTGGGGACCCTGGGGGAGGAGG - Intergenic
1114460735 14:22884740-22884762 TCTGGGGGCCCCAGGGGCAGAGG - Exonic
1114553943 14:23550962-23550984 GCGGGGATCCCGGGGGGAAGGGG - Intronic
1114615003 14:24063562-24063584 TCTGGTGTCACTGAGTGAAGGGG - Intronic
1115403870 14:32994109-32994131 TCTGGGGGAGCTGGAGGAAGGGG + Intronic
1115410799 14:33072539-33072561 CCTGGGTTCCCTAGGGAAAGAGG - Intronic
1116143789 14:41037499-41037521 TCTTGGGCACCTGGGGAAAGTGG - Intergenic
1116671278 14:47846116-47846138 ACTGAGTTCCCTGGGGGGAGGGG + Intergenic
1116697752 14:48199598-48199620 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
1117240262 14:53825143-53825165 TCTGTGGCCCCTGGGGGTTGAGG - Intergenic
1118311818 14:64699337-64699359 ACTGCGGCCTCTGGGGGAAGGGG - Intergenic
1119729444 14:76941807-76941829 TCTGGTGTCCTTGGGGAAAGGGG - Intergenic
1120840394 14:89080442-89080464 ACTGGGGGCCCTGGGAGAAAAGG - Intergenic
1121045774 14:90786384-90786406 TCTGGGGTCCCTTGAGTGAGGGG - Intronic
1121273340 14:92652019-92652041 TCTGGGGGACCTGGGGCATGGGG - Exonic
1121409762 14:93741645-93741667 TCAGGAGTCTCCGGGGGAAGAGG + Intronic
1121700946 14:95953599-95953621 TCTGGGCTCCTTGGAGGAAGGGG + Intergenic
1122151551 14:99728678-99728700 TTTGGGGTGGCTGTGGGAAGGGG - Intergenic
1122694069 14:103544389-103544411 TCTGGGGCTCCTGGGGGAGGGGG - Intergenic
1122830720 14:104394338-104394360 TGTGTGGTCTCTGGGGGCAGTGG + Intergenic
1122831052 14:104396062-104396084 TCTGGGGTCCGTGGTGGAGGTGG + Intergenic
1122902745 14:104788541-104788563 CCTGGGGTCCCTGCGTGAGGTGG - Intronic
1123387627 15:19831656-19831678 TCTGAGGCCCCTGGTGGAAAAGG - Intergenic
1123418252 15:20108085-20108107 TCTGGGGCCCCTGTGGAAAGAGG - Intergenic
1123527470 15:21114607-21114629 TCTGGGGCCCCTGTGGAAAGAGG - Intergenic
1123709096 15:22973530-22973552 GCTGGGGTGGCTGGCGGAAGGGG - Intronic
1124161861 15:27277907-27277929 GATGTGGTCCCTGAGGGAAGTGG - Intronic
1125411450 15:39410548-39410570 TCTGGAGTCCCTAGGTTAAGAGG + Intergenic
1125521016 15:40347881-40347903 GCTCGGCACCCTGGGGGAAGAGG + Intergenic
1125540130 15:40465465-40465487 CCTGGGGAGCCTGAGGGAAGAGG - Intronic
1126100665 15:45116503-45116525 ACTGGGGTCCCTGTGGGGTGAGG - Exonic
1127195169 15:56576447-56576469 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
1128371644 15:67044179-67044201 TCTGGGAGGCTTGGGGGAAGTGG - Intergenic
1128376930 15:67083390-67083412 ACTGGGGTTCATGTGGGAAGTGG + Intronic
1128603448 15:69016548-69016570 TCTGTGCTCCCTGTGGGAAATGG + Intronic
1129256639 15:74337569-74337591 TCCAGGCTCCCTGGGGCAAGGGG - Intergenic
1129268366 15:74406895-74406917 TCTGGGGTCCCTGGGGGAGAAGG - Intergenic
1129456020 15:75676560-75676582 ACTGGGGTCCCTGGATGAGGCGG + Exonic
1129556063 15:76511086-76511108 TCTGGGGACTCAGGGGGAAAGGG + Intronic
1129656243 15:77527343-77527365 CCTGGGGCCCCTGAGGGAGGAGG - Intergenic
1129740404 15:77987070-77987092 TCTCGCCTCCCTCGGGGAAGGGG + Intronic
1129888650 15:79056450-79056472 TCTGGTAGCCCTGTGGGAAGAGG + Intronic
1130069549 15:80635033-80635055 TCTGGGCTCCCTGGGACAATGGG - Intergenic
1131066091 15:89435841-89435863 GCTGGGCCCCCTGGGGGACGGGG - Intergenic
1131418052 15:92278003-92278025 ACTGGGGTGGCTGGGGAAAGAGG - Intergenic
1132319893 15:100918384-100918406 TCTTGGGTCCCTGGTTGGAGAGG - Intergenic
1132423773 15:101696656-101696678 TCTGGGGTCCTTTGGCCAAGAGG - Intronic
1132719151 16:1307448-1307470 GCTGGGGACCCTGTGGGAGGTGG + Intergenic
1132799999 16:1747297-1747319 TCTGGGCTCCCTCGGGCAGGAGG + Intronic
1132870968 16:2115616-2115638 TCCGGGGTCCCTGTGAGGAGGGG + Exonic
1133133355 16:3692027-3692049 TATGTGGTCCCTGGGGTCAGTGG - Intronic
1133194100 16:4156219-4156241 TCTGGGCTCTCTGAGGGCAGGGG - Intergenic
1133240680 16:4412481-4412503 TCTGGGATCCCTGGGCAAGGAGG - Intronic
1133241337 16:4416191-4416213 TCGGGGGTCCCGGGGCGAGGTGG + Intronic
1134062904 16:11209778-11209800 TCAGGGGACTCTGGGGGATGAGG - Intergenic
1134521561 16:14921267-14921289 TCCGGGGTCCCTGCGAGGAGGGG - Intronic
1134709232 16:16319918-16319940 TCCGGGGTCCCTGCGAGGAGGGG - Intergenic
1134716441 16:16359947-16359969 TCCGGGGTCCCTGCGAGGAGGGG - Intergenic
1134905469 16:17976206-17976228 TCGGGGGTTTGTGGGGGAAGGGG - Intergenic
1134950373 16:18348727-18348749 TCCGGGGTCCCTGCGAGGAGGGG + Intergenic
1134958309 16:18392212-18392234 TCCGGGGTCCCTGCGAGGAGGGG + Intergenic
1135339262 16:21632337-21632359 GCACTGGTCCCTGGGGGAAGAGG + Intronic
1135590423 16:23701146-23701168 TAGGGGTTCCCTGGTGGAAGGGG - Intronic
1135961322 16:26996751-26996773 TCTGAGGTCCCTGGGGATGGTGG - Intergenic
1136025040 16:27463583-27463605 TCTGTGAACCCTGAGGGAAGAGG + Exonic
1136317730 16:29464065-29464087 TTTGGGGTTTCTAGGGGAAGTGG + Intronic
1136432305 16:30203410-30203432 TTTGGGGTTTCTAGGGGAAGTGG + Intronic
1136626836 16:31466649-31466671 CCTGGGGTCCCAGGTGGATGCGG - Exonic
1137606041 16:49787540-49787562 TCTGGGGTGCCTGGGAGTAGTGG - Intronic
1137949875 16:52773552-52773574 TTTGGGGACTCGGGGGGAAGGGG + Intergenic
1139062057 16:63264126-63264148 TCTGGAGGCCCTGGTGGAAGGGG + Intergenic
1139280169 16:65763850-65763872 TCTGCGGTCACTGGGGGAGTGGG + Intergenic
1139695255 16:68669699-68669721 TCTGGGTTACCTGGTGGGAGAGG + Intronic
1140910126 16:79443456-79443478 CCTGGGCTTCCTGGGGGCAGTGG + Intergenic
1141491705 16:84378235-84378257 TCTGGGGGCTCTGGGCGTAGGGG + Intronic
1141580950 16:84998328-84998350 ACAGGGGTCCCTGGGAGAAAAGG + Intronic
1141636738 16:85317906-85317928 CCCGGGGTTCCTGGGGGAGGTGG + Intergenic
1141756837 16:85996987-85997009 ACTGCAGGCCCTGGGGGAAGCGG - Intergenic
1141884550 16:86882665-86882687 TCTGTGGCCCCTGGAGGTAGGGG - Intergenic
1142155724 16:88532165-88532187 TCTTGCGGCACTGGGGGAAGGGG - Exonic
1142224817 16:88872262-88872284 TCTGGGGTCCGTGGGTGGAGAGG + Intergenic
1142467035 17:141951-141973 TCCGGGGTCTCTCGGGGAAACGG - Intergenic
1142604970 17:1076550-1076572 TCTTGGGTCCCAAGAGGAAGAGG + Intronic
1143151036 17:4807655-4807677 TCAGGAGGCCGTGGGGGAAGAGG + Intronic
1143508027 17:7380316-7380338 TCTGGGACCCCTGAGAGAAGCGG + Intergenic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1143558054 17:7674824-7674846 ACTGGGGTCTCTGGGAGGAGGGG - Intronic
1143620103 17:8075781-8075803 TCAGGGCACCCTGGGGGAGGTGG - Intronic
1143987176 17:10924748-10924770 TCTGGGGTGACTGGGAGAGGAGG + Intergenic
1144779014 17:17798659-17798681 TCTGGGGTGTGTGGGGGAAGTGG + Intronic
1146908577 17:36633372-36633394 CCTTGGGTCCGTGAGGGAAGAGG + Intergenic
1146947151 17:36881380-36881402 GCTGGGGTCCCTTGGGCATGTGG + Intergenic
1147163038 17:38578856-38578878 AAGGGGGTCCCTGCGGGAAGGGG + Intronic
1147177390 17:38664274-38664296 TGTGGAGTCCCTGGGGGTAGAGG - Intergenic
1147496004 17:40916415-40916437 TCTGTGATGCCTGGGGGCAGTGG + Intergenic
1147668105 17:42161458-42161480 TCTGAGATCCCTTGGGGAGGAGG + Intronic
1147965379 17:44191950-44191972 GCTGGGGTCATTGGGGGAGGGGG - Exonic
1148109496 17:45136679-45136701 CCAGGCGTCCCTGGGGGCAGAGG - Exonic
1148131990 17:45267564-45267586 TCTGGGGGCTCTGGTGGGAGAGG + Exonic
1148175128 17:45557323-45557345 CCTTGGGATCCTGGGGGAAGAGG + Intergenic
1148210778 17:45807145-45807167 TCTGGGATACCTGGGGTAGGGGG - Intronic
1148296243 17:46505704-46505726 CCTTGGGATCCTGGGGGAAGAGG - Intergenic
1148674812 17:49439002-49439024 CCTGGAGTGCTTGGGGGAAGGGG + Intronic
1148759327 17:49991371-49991393 GCTTGGGTCCCTGGAGGAAGGGG + Exonic
1148894621 17:50832676-50832698 CCTGGTGTCCTTGGGGAAAGGGG + Intergenic
1149210084 17:54291607-54291629 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
1149685263 17:58531406-58531428 TCTGGGGTCCCTTTGGGAAAGGG + Intronic
1150300569 17:64043998-64044020 TCTGGAGTCACTGGGGGCTGGGG + Exonic
1150789942 17:68195832-68195854 CCTGGGGCCCCTGAGGGCAGGGG + Intergenic
1151398846 17:73842726-73842748 TCTGGGGTCCCCGGGCAGAGGGG - Intergenic
1151473079 17:74329988-74330010 TCTGGGCTCCCCAGGGGCAGGGG + Intronic
1151568429 17:74913462-74913484 GCCCTGGTCCCTGGGGGAAGAGG - Intergenic
1151569108 17:74917338-74917360 TCTGGGGTCCCTGGGGGGCCAGG + Exonic
1151665746 17:75544291-75544313 TCCTGGCTCCCCGGGGGAAGAGG - Intronic
1151817520 17:76478650-76478672 GCTGGGATCCCTGGGCAAAGAGG - Intronic
1151821854 17:76501073-76501095 TAAGGGGTCCCTGGGCGACGGGG - Intronic
1152603830 17:81278915-81278937 CCGGGGGTCCCTGGGGTAGGTGG - Intronic
1153480653 18:5543576-5543598 CCTGGGATCCCTGGCCGAAGGGG - Intronic
1153948175 18:10035131-10035153 CCTGGGGCTCCTGAGGGAAGAGG - Intergenic
1154387629 18:13909822-13909844 TCAGGGATCCCTGGGGGAAGTGG - Intronic
1155464528 18:26120426-26120448 GATGGAGTGCCTGGGGGAAGAGG + Intergenic
1155565619 18:27131221-27131243 TCTGGGGTCCCTGGGCCAGGAGG - Intronic
1157182975 18:45513858-45513880 TGTGGGGTCCCTGTGGAAACTGG - Intronic
1157310564 18:46549627-46549649 TCTAGGATCCCTGGAGGAATGGG + Intronic
1157801466 18:50625028-50625050 TCTGGGGTACCTGGAAGATGAGG + Intronic
1157857163 18:51113742-51113764 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1158589720 18:58768993-58769015 TCTGGGGCCCCTGGGGCAGGGGG + Intergenic
1158960458 18:62583844-62583866 TCTGGGGTCCCAGGGCTGAGAGG + Intronic
1159191761 18:65054641-65054663 GCTGGGGTCCTTGTAGGAAGAGG + Intergenic
1159700218 18:71617274-71617296 TCTGGGGAGGCTGGGGCAAGAGG - Intergenic
1159812972 18:73038998-73039020 ACTGGGGCCTCTGGGAGAAGAGG - Intergenic
1159948009 18:74457875-74457897 TCAGGGGTGCCCGTGGGAAGGGG - Intronic
1160602453 18:80024117-80024139 TCAGGGATCCCTGGAGGAAGAGG - Intronic
1160800228 19:964235-964257 ACAGGTGTCCCTGGGGGAAGGGG - Exonic
1160914906 19:1491716-1491738 GCCGGGGTCCACGGGGGAAGGGG - Intronic
1160968563 19:1757424-1757446 TCAGGGGTGCGTGGGGGAACCGG + Intronic
1160978465 19:1805847-1805869 GCTGGGGACCCTGGGGGGTGGGG - Intronic
1161026575 19:2039919-2039941 TGTGAAGGCCCTGGGGGAAGGGG + Intronic
1161040834 19:2110037-2110059 CCAGGTGTCCCTAGGGGAAGTGG - Intronic
1161063542 19:2226919-2226941 ACTGCGGTCCCGGCGGGAAGGGG - Exonic
1161064555 19:2231278-2231300 TCTGTGGCACCTTGGGGAAGGGG - Exonic
1161070454 19:2257305-2257327 TCTGGGAGTCCTGAGGGAAGAGG + Intronic
1161353978 19:3809050-3809072 CCTGGGGTCCCTGGGACAGGAGG + Intronic
1161358294 19:3831869-3831891 TCTTGGGTCCCTAGGGGACAGGG + Exonic
1161369509 19:3902665-3902687 CCTGGGGTCTATGGTGGAAGTGG + Intronic
1161430528 19:4229621-4229643 TGTGGGGCCCCTGGGGGACTGGG + Intronic
1161485222 19:4531842-4531864 CAGGGGGACCCTGGGGGAAGTGG + Intronic
1161589756 19:5124009-5124031 GCTGGGGTCCCTGGGGGTGGGGG + Intronic
1161752605 19:6109314-6109336 TATGGGGTCACAGGGAGAAGGGG + Intronic
1161818965 19:6517201-6517223 CCTGGGTTCCCTGGCGGGAGTGG + Intergenic
1161837879 19:6660081-6660103 GCGGGGGTCCCTGGGGGAGAGGG + Intergenic
1162108296 19:8384571-8384593 GCGCTGGTCCCTGGGGGAAGAGG - Intronic
1162159660 19:8702475-8702497 TCTGGGGTGACTGGGGCAAGAGG - Intergenic
1162201744 19:9025452-9025474 TCTGAGCCCCCTGGGGGCAGGGG - Intergenic
1162237044 19:9317576-9317598 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
1162366449 19:10252399-10252421 CCTGAGTTCCCTGGCGGAAGAGG + Exonic
1162545978 19:11330024-11330046 TCTGGGGTCTCGGGGTAAAGGGG - Intronic
1162777747 19:12990112-12990134 TCTGGGGGTCCTGGGTGAAGAGG - Intergenic
1162778382 19:12993946-12993968 GCTGGGGACCCTGGAGCAAGGGG - Intergenic
1162936283 19:13983302-13983324 CCAGGCCTCCCTGGGGGAAGTGG - Intronic
1162956586 19:14102223-14102245 TGTGGGGTCCCTCGGAGAACAGG + Intronic
1163207773 19:15815967-15815989 TCTGCAGTCCCTGGGGGCAATGG - Intergenic
1163430197 19:17262797-17262819 TCTGAGCTCCCTGGAGGCAGCGG - Exonic
1163568040 19:18063464-18063486 TCTGGGGGCTCTTGGGGAGGAGG - Intronic
1163664972 19:18598892-18598914 TCTGGGGGCACTGGGAGAAGGGG + Exonic
1163790468 19:19303189-19303211 TCTGGGGTCACTCTGGGAATGGG - Intronic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1164451797 19:28372486-28372508 TATGGGATACATGGGGGAAGGGG - Intergenic
1164655836 19:29921150-29921172 TATGGGGCCCCTGGAGGCAGTGG - Intergenic
1165329095 19:35131546-35131568 GCGGAGGTCCCTGGGGCAAGAGG + Exonic
1165632532 19:37313612-37313634 TCTGAGGTCCCTGGGGTGACAGG - Intronic
1165774057 19:38394801-38394823 CCTGGGGCTCCTGGGGGAATGGG + Intronic
1165925110 19:39321468-39321490 TTTGGGGTCCGTGAGGGAAGGGG - Intergenic
1165988344 19:39790289-39790311 TCTGGGGTCATTGGGGGTAAAGG + Intergenic
1166310973 19:41962407-41962429 AATGGGGTCCCTGAGGGAAGGGG + Intergenic
1166314009 19:41978562-41978584 TCTGGGGTCCCTGGAGGGCAAGG - Intronic
1166367707 19:42285720-42285742 GCCTGGCTCCCTGGGGGAAGTGG - Intronic
1166706108 19:44908890-44908912 CCTGGGGCCCCTGGTGGAACAGG + Exonic
1166713448 19:44951589-44951611 TCTGGGGGCCCTGAGGGGAATGG - Intronic
1166874831 19:45890915-45890937 ACTGGGGTTCCTGGCAGAAGGGG + Exonic
1166888204 19:45973836-45973858 TCTTGGCTCCCTGGGGCAAGAGG + Intergenic
1167250348 19:48395822-48395844 TCCTGGGTCCTTGGGGGAAGAGG + Intronic
1167306572 19:48713405-48713427 CGTGGGGTCCCTGGGAGAAGGGG + Exonic
1167476973 19:49706749-49706771 TCTGGGGTCCCTGGGCCTAGGGG - Intronic
1167799458 19:51730605-51730627 TCTGGGGTCTGAGGGAGAAGGGG + Intergenic
1168295763 19:55376815-55376837 CCTGGGGCCACTGTGGGAAGAGG - Exonic
1168720376 19:58551502-58551524 ACTGGGGTCCCTGGGAGGATGGG - Intergenic
1202687774 1_KI270712v1_random:61392-61414 TCCGGGGCCCCTGTGGAAAGAGG - Intergenic
925611032 2:5703370-5703392 TCTGGGGTATCTGGGAGAGGCGG + Intergenic
925949493 2:8897591-8897613 GCACTGGTCCCTGGGGGAAGAGG + Intronic
927244471 2:20945917-20945939 ACTGAGGGGCCTGGGGGAAGAGG - Intergenic
927865078 2:26583040-26583062 TGTGGGGTCACTGGGGTCAGGGG - Intronic
928158455 2:28897894-28897916 TCTTTGGAGCCTGGGGGAAGAGG + Intronic
928262905 2:29783783-29783805 ACTGGGTTCCCTGGGGATAGAGG + Intronic
928757608 2:34545625-34545647 TTTGAGCTCACTGGGGGAAGGGG - Intergenic
928948457 2:36792752-36792774 TCAGGGGTCACTGGGGGACTGGG - Intronic
930038936 2:47105709-47105731 GCACTGGTCCCTGGGGGAAGAGG - Intronic
930573407 2:53114881-53114903 TTTGTGTTCCCTGGGGGCAGGGG - Intergenic
930609887 2:53530325-53530347 TCTGGTGTCCCTGGGGAAGCTGG - Intergenic
931323284 2:61193699-61193721 CCTGGGGACCCTAGGGGATGTGG - Intronic
931687037 2:64802991-64803013 TCTGGGCATCTTGGGGGAAGTGG + Intergenic
932454095 2:71835101-71835123 GCTGGGGTTCCTGGGGGATTGGG + Intergenic
932497778 2:72155235-72155257 CCTGGGGGCCCTGCGGGAGGAGG - Intergenic
933774842 2:85765712-85765734 TCTGCCTTCCCTGGGTGAAGAGG - Intronic
933958580 2:87394193-87394215 TCCGGGGCCCCTGTGGAAAGAGG + Intergenic
934242709 2:90286199-90286221 TCCGGGGCCCCTGTGGAAAGAGG + Intergenic
934270466 2:91530484-91530506 TCCGGGGCCCCTGTGGAAAGAGG - Intergenic
934622917 2:95826514-95826536 TCTGAGTTCCCTGGGGGAGGGGG - Intergenic
934810854 2:97275589-97275611 TCTGAGTTCCCTGGGGGAGGGGG + Intergenic
934826838 2:97432350-97432372 TCTGAGTTCCCTGGGGGAGGGGG - Intergenic
935215204 2:100970398-100970420 TGTGGAGACCCTGGGGCAAGAGG - Intronic
936965707 2:118125859-118125881 TCTGAGCTCTCTGGAGGAAGGGG - Intergenic
937423685 2:121779372-121779394 TATGTGTTCCCTGGGGGATGGGG + Intergenic
937776091 2:125777285-125777307 TCTGGGGTGACTTGGAGAAGAGG - Intergenic
937820656 2:126306987-126307009 TCTGGTGTCCTTATGGGAAGAGG - Intergenic
939789613 2:146555538-146555560 TCTGTGGTGCCTATGGGAAGTGG - Intergenic
940581251 2:155583973-155583995 TCTGGAGGCCCTGTGGGGAGGGG - Intergenic
941391945 2:164925553-164925575 TGTGGGATCCTTGTGGGAAGAGG - Intronic
941680125 2:168389081-168389103 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
941916067 2:170814854-170814876 TCTGGGGTCAAAGGAGGAAGTGG + Intronic
942322044 2:174744289-174744311 TCAGGGGTGTCTGGGGAAAGAGG - Intergenic
943134143 2:183890553-183890575 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
944729398 2:202502028-202502050 GCACTGGTCCCTGGGGGAAGAGG - Intronic
945700180 2:213159938-213159960 AGTGGGGTCCCTGAGGGAATAGG + Intergenic
946206410 2:218112066-218112088 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
946439270 2:219681321-219681343 TCTGAGCTCCCTCTGGGAAGGGG - Intergenic
946640456 2:221778205-221778227 CCTGGGGGCCCTGTGTGAAGAGG - Intergenic
946809647 2:223510035-223510057 TTTGTGCTCCCTGGTGGAAGTGG - Intergenic
947924786 2:233911704-233911726 TGTGGGCTCCCTGGGGGAAGGGG + Intergenic
947948215 2:234124727-234124749 CTTGGGGTCCCTGGGGGTTGTGG + Intergenic
948065102 2:235072464-235072486 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
948261556 2:236607764-236607786 ACTGGTGTCCCTAGAGGAAGAGG - Intergenic
948765591 2:240217131-240217153 GCTGGGGCCCCTGGGTGAGGTGG + Intergenic
948890465 2:240904829-240904851 TCTTGGGTCCCTGGGGGATCTGG + Intergenic
949053611 2:241911707-241911729 TCAGGGATCCCTGGAGGAAAGGG + Intergenic
949065567 2:241988240-241988262 TCTGGGGTCCATGCGTGGAGAGG + Intergenic
1168806167 20:673540-673562 TCTGGAGACCCATGGGGAAGGGG + Intronic
1168880377 20:1201434-1201456 TCTGAAGTTCTTGGGGGAAGGGG + Intergenic
1169067277 20:2701228-2701250 TCTGGGCTGCCTCGGGGCAGTGG + Intronic
1169430924 20:5535595-5535617 TGTGGGCTTCCTGAGGGAAGTGG - Intergenic
1169557471 20:6766677-6766699 TCTTGGGGGCCTGGTGGAAGAGG + Intergenic
1169838600 20:9908637-9908659 GATGGGGGTCCTGGGGGAAGTGG - Intergenic
1171270883 20:23815973-23815995 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
1171329967 20:24328860-24328882 ACAGGGGTGGCTGGGGGAAGAGG + Intergenic
1172057557 20:32165008-32165030 TCTGGGGTCTGTGGGGGACCAGG + Intronic
1172274085 20:33670412-33670434 CCTCTGGTCCCTGTGGGAAGCGG + Intronic
1172294139 20:33796511-33796533 TCTGGTCTCCCTGGGGTGAGAGG - Intergenic
1172512087 20:35507856-35507878 GCTGGGGGCTCTGGGGGAACAGG + Intronic
1173097401 20:40048877-40048899 TCTGTGGTCCTTGGGTGCAGTGG + Intergenic
1173400495 20:42721921-42721943 TCATGAGTCCCTGGGGGATGTGG - Intronic
1173471682 20:43328433-43328455 TTTGGGGTCCCTGGAGGACTGGG + Intergenic
1173995667 20:47336891-47336913 TCTGGGGATGCAGGGGGAAGGGG - Intronic
1174444434 20:50581040-50581062 TCTGAAGTACCTGGGGGAGGGGG + Intronic
1174554171 20:51382312-51382334 TCTGGGGGCTCTGGGGGAGAAGG - Intergenic
1174661308 20:52215454-52215476 TCTGGAGGCTCTGGGGGAATCGG - Intergenic
1174783975 20:53415466-53415488 CATGGGGTGCCTGGAGGAAGAGG - Intronic
1174881951 20:54289496-54289518 TCTGTGGGGCCTTGGGGAAGGGG + Intergenic
1175105471 20:56611662-56611684 TCTGGAGTCCTTGGTGGAACAGG - Intergenic
1175250282 20:57605032-57605054 TTTGGGGTCCCTGGGAGGACTGG - Intronic
1175724871 20:61310834-61310856 ACTGGTGTCCCTGTGGGAAGAGG - Intronic
1175741129 20:61420430-61420452 CCTGGGGACCCTGTGGGGAGGGG - Intronic
1175762505 20:61571158-61571180 GCCGGTGTCCCTGGAGGAAGAGG - Intronic
1176034512 20:63029655-63029677 TCTCGGGTCCCGAGGGGAACTGG + Intergenic
1176218973 20:63961123-63961145 TCTGGCTTCCCTGGGAGAACTGG - Intronic
1176239266 20:64068411-64068433 GCAGGGGGCCTTGGGGGAAGAGG - Intronic
1176430003 21:6569675-6569697 GCTGGGGTCCCTGGGGGCTCTGG + Intergenic
1177107003 21:16969331-16969353 ACTGGGGGCACTGGGGGCAGAGG + Intergenic
1178109620 21:29357204-29357226 GCGCTGGTCCCTGGGGGAAGAGG + Intronic
1178615842 21:34132163-34132185 TCTTGGTTCCCTGGGAGAAGAGG + Intronic
1179307268 21:40166250-40166272 TGTGGCGTCACTGGGAGAAGAGG - Intronic
1179314028 21:40225369-40225391 CCTGAGATCGCTGGGGGAAGAGG - Intronic
1179433739 21:41345211-41345233 TCTGGTGTTTCTGTGGGAAGAGG + Intronic
1179593354 21:42426144-42426166 ACTGGGGTCCCATGAGGAAGGGG - Intronic
1179705397 21:43177137-43177159 GCTGGGGTCCCTGGGGGCTCTGG + Intergenic
1179710475 21:43210406-43210428 TCCGGACTCCCCGGGGGAAGAGG - Intergenic
1179882233 21:44297712-44297734 TCTGGGGTCAGGAGGGGAAGGGG - Exonic
1179950095 21:44704409-44704431 TTTGGGTTCCCTGGGGGTTGGGG - Intronic
1180073466 21:45450170-45450192 TCTCTGGTCCCTGGGGAAGGAGG + Intronic
1180092159 21:45538717-45538739 GCTGGGGTCCCTGGGCTCAGGGG - Intronic
1180873264 22:19159989-19160011 TCTGGGGTCCTTTGGTCAAGGGG - Intergenic
1181235949 22:21447701-21447723 TCTGGGGTTCCGGGGGGTGGGGG + Exonic
1181310116 22:21939986-21940008 GCTGGGGACCCTGGGGGGTGGGG + Intronic
1181350367 22:22250804-22250826 TCCGGGGCCCCTGTGGAAAGAGG - Intergenic
1181459024 22:23075384-23075406 TCTGTGGACCCTTGGGCAAGAGG + Intronic
1181528867 22:23504755-23504777 TCGCGGGTCCCTTGGGGCAGAGG - Intergenic
1181730810 22:24845008-24845030 TGTGGGCTGCCTCGGGGAAGTGG + Intronic
1181804777 22:25368029-25368051 TCTGAGGTCCCGGTGGGCAGAGG - Intronic
1182446589 22:30393243-30393265 TCTGTGGTGCCAGGGGGAAGGGG - Intronic
1182895452 22:33855661-33855683 TCTGTGGTTCCTGGGGGCAGAGG - Intronic
1183341343 22:37283583-37283605 TCTGGGTTCCCTGGGGCCCGAGG - Intronic
1183344425 22:37299213-37299235 GATGGGATCCCTGGGGGAGGAGG - Exonic
1183354166 22:37349568-37349590 TCTGATGTCCCTGGGGTAGGAGG - Intergenic
1183705109 22:39471136-39471158 TCTGGGAGCCCTGGGGGTGGGGG + Intronic
1184379565 22:44136583-44136605 GCTGGTGTCCCTGGCTGAAGTGG - Intronic
1184387710 22:44185832-44185854 TTTGGGGTCCTTCCGGGAAGTGG - Exonic
1184439505 22:44500217-44500239 TCTGGGGTCCCCTGGCCAAGAGG - Intergenic
1185092125 22:48781556-48781578 TCTGGGGTCCCCGGGGACTGGGG + Intronic
1185233126 22:49694648-49694670 TCTGGGGTGCCTGGGGTATCTGG + Intergenic
1185296598 22:50057973-50057995 TCTGGGATTCCTAGGGTAAGGGG + Intergenic
1185385236 22:50528871-50528893 TCTGGGGACCCAAGGGGAAAGGG + Intronic
949619805 3:5797914-5797936 TCTGGAGACCCAGGTGGAAGTGG + Intergenic
949949985 3:9221118-9221140 ACTGCTGTTCCTGGGGGAAGGGG - Intronic
950029235 3:9841002-9841024 TCTGAGTTCCCTGGGGGCCGGGG - Intronic
950615150 3:14152301-14152323 TGGGGGGTCCCTGTGGGGAGTGG - Intronic
951239720 3:20273850-20273872 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
952453431 3:33451759-33451781 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
952940576 3:38441324-38441346 TCGCTGGTCCCTGGGGGAAGAGG + Intergenic
953103435 3:39852543-39852565 TTTGGGGACTCAGGGGGAAGGGG - Intronic
953228971 3:41046405-41046427 TCTGGGGAAACTGGAGGAAGGGG - Intergenic
953238349 3:41125950-41125972 TCAGGGGTCTCTGGGGGTAATGG + Intergenic
953622556 3:44545816-44545838 TCGCTGGTCCCTGAGGGAAGAGG + Intergenic
953683210 3:45055780-45055802 TTTGTGCTCCCTGGGAGAAGGGG + Intergenic
953910832 3:46892230-46892252 TCTGGTGTCTCTGGGGGCTGAGG - Intronic
954204378 3:49047399-49047421 TTTGCTGTCCCTGGGGCAAGAGG - Intronic
954223860 3:49170699-49170721 TCAGTGGTACCTGTGGGAAGAGG - Intergenic
954231962 3:49224604-49224626 GCGCTGGTCCCTGGGGGAAGAGG + Intronic
955398376 3:58573506-58573528 TCTGGGGTCCATCCGGGGAGTGG + Intronic
955418538 3:58715077-58715099 ACGGGGGTGGCTGGGGGAAGAGG + Intergenic
955440338 3:58948031-58948053 ACTTGGGTCCATGGGTGAAGTGG + Intronic
956202273 3:66718988-66719010 TCAGGGGCCGCTGGGGGGAGGGG + Intergenic
959715201 3:109425134-109425156 TTTGGGGGCTCTGGGGTAAGGGG - Intergenic
959883560 3:111473785-111473807 ACTGAGATCCCTGGGGGGAGGGG - Intronic
961513626 3:127419703-127419725 TCTGGGGACCCATGGGAAAGAGG - Intergenic
961518751 3:127455161-127455183 CCTGGGTTGCCTGGGGAAAGGGG - Intergenic
962710519 3:138081934-138081956 TCTGGGGTCCGTGTGTGAAAGGG + Intronic
963975975 3:151480948-151480970 ACTGAGGTCCCTGGGGGACAGGG - Intergenic
964916601 3:161848648-161848670 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
965139583 3:164816605-164816627 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
965454987 3:168888555-168888577 TCTAGCGTTCCTGGGGCAAGGGG - Intergenic
965458154 3:168929774-168929796 TCTGTGGCCCCTACGGGAAGTGG + Intergenic
966418866 3:179717893-179717915 TCATGGGCCTCTGGGGGAAGAGG + Intronic
966445792 3:179999343-179999365 ACAGGGGTGGCTGGGGGAAGAGG - Intronic
966774661 3:183533380-183533402 ACTGGGGAGCCTGAGGGAAGAGG - Intronic
967667871 3:192196011-192196033 GCTGGGGTGGTTGGGGGAAGGGG - Intronic
967980339 3:195061575-195061597 CCTGGGGTCCCTGGGAAAGGAGG + Intergenic
968286449 3:197511851-197511873 TCAGGGATCCCTGGTGGAAGGGG - Exonic
968618977 4:1595185-1595207 GCGGGGGTCCCTGTGGGCAGAGG - Intergenic
968729887 4:2264683-2264705 TCTGGAGCCCCTGGGGGATAGGG + Intergenic
968761462 4:2444481-2444503 TGTGGGCTCCCAGGGGGCAGAGG - Intronic
968890944 4:3368118-3368140 TCTGGGGGCCCTGGGGGGCCAGG + Intronic
969117089 4:4877417-4877439 TCTGGGCTCCGTGAGGGCAGTGG + Intergenic
969298684 4:6284630-6284652 CCTGGGGTCTCCTGGGGAAGTGG + Intronic
969354968 4:6619941-6619963 GCTGGGGTCCGTGGTGGCAGTGG + Exonic
971280807 4:25241261-25241283 ACACTGGTCCCTGGGGGAAGAGG + Intronic
972132914 4:35860045-35860067 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
972511165 4:39770034-39770056 GCTGGGGTCCCTGGGCTAGGTGG - Intronic
974174892 4:58309474-58309496 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
974289666 4:59913525-59913547 TCAGGGGTGGCTGGGGAAAGAGG - Intergenic
974537500 4:63189751-63189773 GCTCTGGTCCCTGGAGGAAGAGG - Intergenic
974828061 4:67154362-67154384 TCCTGTGTCCCTGGGGGGAGTGG - Intergenic
975595441 4:76045071-76045093 GCACTGGTCCCTGGGGGAAGAGG + Intronic
976278948 4:83307677-83307699 TCTGGGGTGTCGGGGAGAAGGGG - Intronic
977736030 4:100417132-100417154 TCTGGTGTGCCTAGGAGAAGAGG + Exonic
977833130 4:101617057-101617079 ACTGGGGTGGCTGGGGAAAGAGG + Intronic
977884548 4:102241209-102241231 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
979372922 4:119911159-119911181 CATGAGGTCCATGGGGGAAGGGG + Intergenic
979743351 4:124179081-124179103 TCTTGTTTCCCAGGGGGAAGAGG - Intergenic
980290526 4:130844105-130844127 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
982086593 4:151842164-151842186 TCTTGGGTACCTGAGGGAGGAGG + Intergenic
982315329 4:154025515-154025537 TCAGGGGACCCTGGGGGCACTGG + Intergenic
985532661 5:443174-443196 TCCGGGGTCCCGGCCGGAAGTGG - Exonic
985622261 5:961835-961857 TCTGGGGGCCTTGGGAGGAGTGG - Intergenic
985804626 5:2033422-2033444 ACTGGGGGCCCCGGGGGAAATGG - Intergenic
986710139 5:10482648-10482670 ACTGGGGTCCTGGTGGGAAGGGG + Intergenic
986933541 5:12855594-12855616 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
987578242 5:19757528-19757550 TCAGGGGTGGCTGGGGAAAGCGG + Intronic
987930946 5:24398685-24398707 ACACTGGTCCCTGGGGGAAGAGG - Intergenic
988433584 5:31147900-31147922 TCTGAGGTCCATGGGGGCAGGGG - Intergenic
988914177 5:35875769-35875791 TCTGGGCTCCCTGGGGCTGGAGG + Intronic
989617584 5:43352432-43352454 TTTGGGATGCCTGGGTGAAGAGG - Intergenic
991230097 5:64322825-64322847 TTTGGGGACCCAGGGGGAAAGGG + Intronic
992049747 5:72931423-72931445 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
992120024 5:73583439-73583461 TCATGGACCCCTGGGGGAAGAGG - Intergenic
992124476 5:73626409-73626431 CCTGGGGACCCTGGAGAAAGTGG - Intronic
992754948 5:79895430-79895452 TCTGGGGTCCCCTGGCCAAGGGG + Intergenic
992896149 5:81246707-81246729 TCTGGGATCCCTGTGAGAACGGG + Intronic
992974771 5:82103565-82103587 TCTTAAGTCCCTGGGGGCAGGGG - Intronic
994454382 5:99985743-99985765 ACACTGGTCCCTGGGGGAAGAGG - Intergenic
994833929 5:104823850-104823872 TCTGGGGACTCAGGGGGAAAGGG - Intergenic
996098991 5:119428688-119428710 GCTCTGGTCCCTGGGGGAAGAGG + Intergenic
997072633 5:130637775-130637797 GCTCTGGTCCCTGGGGGAAGAGG - Intergenic
997239570 5:132296527-132296549 TCTGTGGCACCTGTGGGAAGTGG + Intronic
998111836 5:139508447-139508469 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
998131110 5:139651396-139651418 GCTGGGGTGGGTGGGGGAAGGGG + Intronic
998183694 5:139962844-139962866 TCTGGTCTGCCTGGGGCAAGAGG - Intronic
998401903 5:141852706-141852728 TCAGGGGTCCCATGGGGGAGGGG - Intergenic
998418851 5:141965411-141965433 TCCGGTGTCCCTGGGGACAGGGG + Intronic
998915304 5:147005324-147005346 GCACTGGTCCCTGGGGGAAGAGG - Intronic
999692641 5:154162015-154162037 TCTGAGGTTCCTGGGGGATGAGG - Intronic
999819392 5:155210422-155210444 TCTGCGGTCCCTTGGCCAAGAGG + Intergenic
1000157550 5:158566564-158566586 TATGAGTTCCATGGGGGAAGGGG + Intergenic
1001034384 5:168287151-168287173 TCAGCGGTCTCTGTGGGAAGAGG - Intergenic
1001189400 5:169613983-169614005 TTTGGGGACTCAGGGGGAAGGGG + Intergenic
1001693253 5:173648523-173648545 TCTGGGGACCCAGGAGGATGGGG - Intergenic
1002209186 5:177585855-177585877 TCTGGGGACTCAGGGGGAAAGGG - Intergenic
1002300759 5:178256264-178256286 TCTGGGGTCTCTGTGGGGACAGG + Intronic
1002473435 5:179451052-179451074 TCCGGGGAACCTGGCGGAAGAGG - Intergenic
1002566670 5:180116045-180116067 TCTGGGCTTCCTGGAGGCAGTGG + Intronic
1003601143 6:7518676-7518698 TCTGGGTTCCCTGATGGAAGAGG - Intergenic
1004193951 6:13487598-13487620 TCTGGGATCCCGCGGGGACGAGG + Intronic
1004562199 6:16761315-16761337 TCTGGGGTTGCGTGGGGAAGGGG + Exonic
1004812617 6:19276345-19276367 TCGCAGGTCCCTGGGGGAAGAGG - Intergenic
1005016755 6:21381754-21381776 GGTGGTGACCCTGGGGGAAGTGG + Intergenic
1005997329 6:30939438-30939460 GCTTGGGTCCCTGGGGAAAGGGG + Intergenic
1006455891 6:34131657-34131679 TCTGGGGGCCCAGGTAGAAGTGG - Intronic
1007406947 6:41640710-41640732 TCTGGGGTGGCTGAGGGAGGAGG - Intronic
1007576864 6:42930658-42930680 TCTGGGGGCCCTGGGGTTACGGG - Intronic
1007698032 6:43746315-43746337 TCAGTGGTCTCTGGGGGAGGAGG + Intergenic
1007902360 6:45423273-45423295 TTTGGGGATCCTGGGGGAAAGGG - Intronic
1007922797 6:45626079-45626101 ACTTGGGTCCTTGGGGGTAGGGG - Intronic
1009407343 6:63328127-63328149 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1009471178 6:64029751-64029773 GCACTGGTCCCTGGGGGAAGAGG - Intronic
1009598772 6:65771460-65771482 CCCGGGGGCTCTGGGGGAAGAGG + Intergenic
1010681823 6:78807570-78807592 GCTGGGCTCCCTGGGGGGGGGGG + Intergenic
1011054889 6:83193828-83193850 TCCTGGGTCCCTCGGGGCAGAGG + Exonic
1011319493 6:86074963-86074985 TTTGGGGACCCAGGGGGAAAGGG - Intergenic
1011374681 6:86676262-86676284 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1011633807 6:89352507-89352529 GCTGGGGCCCCTGGGCGAGGAGG - Intronic
1012544042 6:100396083-100396105 TCTGGGTTCACTGGAAGAAGAGG - Intronic
1013422474 6:109978972-109978994 TCTGGGGTCCCAGGGTGGGGTGG + Intronic
1017967694 6:159280802-159280824 TCAGGGGTCCCTGAGTGTAGAGG - Intergenic
1018088940 6:160329176-160329198 TTTGGAGTGCCTGGGGGAAAGGG + Intergenic
1019134210 6:169898077-169898099 ACCGGGGTCCCTGGAGAAAGTGG - Intergenic
1019139983 6:169936963-169936985 GCTGGTGTCCTTAGGGGAAGAGG - Intergenic
1019325437 7:436124-436146 TCTGGGGTCTCGAGGGGAAGAGG + Intergenic
1019353166 7:564635-564657 TCTGGGGATGCTGCGGGAAGAGG - Intronic
1019698642 7:2461469-2461491 GCTGGGGTCCCAGGGGACAGGGG - Intergenic
1019701939 7:2478285-2478307 TTTGGGGTCTGTGGGGGCAGCGG + Intergenic
1019735063 7:2646508-2646530 TCTGGGGACCCGGTGGGGAGGGG + Intronic
1020551088 7:9605702-9605724 TCGGGGGTTCCGGGGGCAAGGGG - Intergenic
1021122664 7:16814846-16814868 ACTAGGGACCCTGGGGAAAGAGG - Intronic
1021756374 7:23856977-23856999 GCACTGGTCCCTGGGGGAAGGGG + Intergenic
1023578821 7:41659428-41659450 TCTGGGGACCCCAGGGGAGGTGG + Intergenic
1023809572 7:43901666-43901688 TCTGGCCACACTGGGGGAAGGGG - Intronic
1023998190 7:45174798-45174820 TCTGGGTTCCAGGGGGCAAGAGG - Intronic
1024226244 7:47328510-47328532 TGTGGGGTCCCAGGGGAATGGGG - Intronic
1024374157 7:48618742-48618764 CCTGGGGTGACTGGGGGAGGTGG + Intronic
1024870424 7:53957584-53957606 GCTCTGGTCCCTGGGGGAAGAGG + Intergenic
1025296777 7:57781867-57781889 TGTGGGGTCCCTGGGGTGAGAGG + Intergenic
1026502599 7:70955834-70955856 TCTGGGGTCCCCTGAGGGAGAGG + Intergenic
1026875580 7:73877277-73877299 CCTGGGGTCCCTGGGGCAGGGGG + Intergenic
1027050370 7:75017938-75017960 CCTGGTGGCCCTGGGGGATGTGG - Intronic
1027125409 7:75553521-75553543 CCTGGCCTCCCTGGAGGAAGAGG - Exonic
1027269344 7:76511528-76511550 TCTGGGGGCCCTGAGGGAGGAGG + Intronic
1027320055 7:77005423-77005445 TCTGGGGGCCCTGAGGGAGGAGG + Intergenic
1027715508 7:81664424-81664446 AATGAGATCCCTGGGGGAAGGGG - Intergenic
1028529171 7:91819148-91819170 TTTGGGGACTCTGGGGGAAAAGG - Intronic
1028532459 7:91852434-91852456 ACTGAGGTCTCTTGGGGAAGGGG - Intronic
1029135331 7:98366429-98366451 TCTGGGGCCCCTGGGGTGAATGG + Intronic
1029495938 7:100895550-100895572 TCGGGGGTCCCCGCGGGAATCGG + Intronic
1029603372 7:101583184-101583206 GCTGGGGTCCCTCAGGGATGAGG + Intergenic
1029714709 7:102319631-102319653 TCTGGGGTGTGTGGGGCAAGAGG - Intronic
1029792586 7:102860494-102860516 TTTGGGGTCACTGGGAGTAGTGG + Intronic
1032395421 7:131586130-131586152 TCTGTCCTCCCTGGGGGAGGTGG - Intergenic
1032759179 7:134922603-134922625 TCGGGGGACACTGGGGCAAGAGG + Intronic
1033365138 7:140667350-140667372 TCTGGGGTCCCAGGGGGACGAGG - Intronic
1033409559 7:141104897-141104919 CCTGAGGTCTCTGGGGGTAGGGG + Intronic
1033589859 7:142800267-142800289 TCAGGGGTACCTGGAGGCAGAGG + Intergenic
1033758864 7:144419796-144419818 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1034321547 7:150188094-150188116 ACTAGGGTACCTTGGGGAAGTGG - Intergenic
1034357166 7:150460178-150460200 TCAGGGGTGGCTGGGGGAAGAGG + Intronic
1034408377 7:150921825-150921847 ACTGGGATGGCTGGGGGAAGTGG + Intergenic
1034556247 7:151852168-151852190 TCGGGGGTCCCTGGGGCTAGGGG + Intronic
1034699960 7:153087318-153087340 TCTGGGGTCCATGGGGGTCCTGG - Intergenic
1034771207 7:153779188-153779210 ACTAGGGTACCTTGGGGAAGTGG + Intergenic
1035679013 8:1474038-1474060 TTTGGGGACTCGGGGGGAAGGGG - Intergenic
1035721780 8:1798171-1798193 TCTGGGGTCCCTGGGGTGCGGGG + Intergenic
1037465441 8:19155279-19155301 TCTGAGTTCCCTGGGGGGAAAGG + Intergenic
1037810606 8:22084444-22084466 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
1037931132 8:22880961-22880983 TCTGCTCTGCCTGGGGGAAGAGG + Intronic
1038256358 8:25954699-25954721 TGAAGGCTCCCTGGGGGAAGGGG - Intronic
1038520563 8:28228923-28228945 TGTGGGTACCCTGGGGAAAGTGG - Intergenic
1038634145 8:29271889-29271911 TCAGGTGTTCCTGGGGAAAGAGG + Intergenic
1038982469 8:32775044-32775066 TCTTGGGTTCCTGGGTGGAGAGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1039999322 8:42563028-42563050 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
1040527979 8:48241069-48241091 GCCCTGGTCCCTGGGGGAAGAGG - Intergenic
1040649299 8:49431282-49431304 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1040667509 8:49651889-49651911 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1040796483 8:51294149-51294171 GCTCTGGTCCCTGGGGGAGGAGG + Intergenic
1040915987 8:52566077-52566099 CCTGGCCTCCCTGGGGGGAGTGG + Intergenic
1040953762 8:52959785-52959807 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1041002280 8:53464707-53464729 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
1042919971 8:73911112-73911134 ACATAGGTCCCTGGGGGAAGAGG - Intergenic
1044005092 8:86929391-86929413 GCGCTGGTCCCTGGGGGAAGAGG + Intronic
1045564402 8:103298923-103298945 TCTCAGGTCCCTGGGGGGAACGG + Exonic
1046646486 8:116791486-116791508 TTTGGGGACTCTGGGGGAAAGGG - Intronic
1047316611 8:123740675-123740697 TCAGGGGTCCCTGAAGGACGTGG - Intergenic
1047807456 8:128375243-128375265 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1048998597 8:139809893-139809915 TCTGGGGTGGCGGGAGGAAGGGG - Intronic
1049020028 8:139950121-139950143 TCAGGTGACCGTGGGGGAAGCGG + Intronic
1049172035 8:141167400-141167422 TCTGGAGCTCCTGGGAGAAGAGG + Intronic
1049255474 8:141611434-141611456 GCTGGGGCCCCTGGATGAAGAGG - Intergenic
1049374224 8:142281407-142281429 GATGGGGTCCCTGTGGGAGGGGG + Intronic
1049388965 8:142358437-142358459 GCTGGGGCCCCTGGGGGGACTGG + Intronic
1049462760 8:142737671-142737693 TCTGGGGTCCTTGGGGGAGGTGG + Intergenic
1049597377 8:143491080-143491102 CCTGGGCTCCCTGGAGGGAGGGG - Intronic
1049778340 8:144416374-144416396 CCTGGGGTCCTGGGGAGAAGAGG + Intronic
1049877314 8:145033167-145033189 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1050457842 9:5850469-5850491 TCTGGGGTGGTTGGGGGAATTGG + Intergenic
1051882373 9:21852540-21852562 TTTGGGGCCTCTGGGGGAAGTGG + Intronic
1053056736 9:34997426-34997448 GCTGGGCTGCCTGGGGGGAGTGG + Exonic
1055458058 9:76491566-76491588 GCGCTGGTCCCTGGGGGAAGAGG + Intronic
1055818842 9:80238275-80238297 TCTGAGCTCTCTGGGGGAGGGGG + Intergenic
1055829403 9:80360505-80360527 TGTGGGGACTCTGGGGGAAGCGG + Intergenic
1056392417 9:86152158-86152180 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
1056424943 9:86466673-86466695 TCCGGGGTCTGTGGGGGCAGTGG - Intergenic
1056910600 9:90696755-90696777 GCTGGGGGCACTGGGGGCAGAGG - Intergenic
1056959788 9:91113002-91113024 TCTGGGTTCTTTGGAGGAAGAGG - Intergenic
1057208009 9:93184770-93184792 TCTGGGGGCCCTGGGAAAGGGGG - Intergenic
1057214008 9:93218333-93218355 TTAGGTGTCCCTGCGGGAAGTGG + Intronic
1057215038 9:93223342-93223364 TCTGAGGTCCCTGGAGGAAGTGG - Intronic
1057503747 9:95616132-95616154 ACTGAGGTCCCTGAGGGGAGTGG + Intergenic
1058261783 9:102842241-102842263 TGGGGGGACACTGGGGGAAGTGG + Intergenic
1058514053 9:105751687-105751709 TCTTGAGTTCCTGGGGGGAGGGG + Intronic
1058801583 9:108549650-108549672 TCTGTGGTCCCTAGGAGAAAAGG - Intergenic
1058867247 9:109172104-109172126 TCTGTGAACTCTGGGGGAAGCGG + Exonic
1059119200 9:111627005-111627027 TCTGGGGCCTCTGAGGGAGGAGG + Intergenic
1059173489 9:112148526-112148548 TCGGGGGTCCTTGGGGTGAGTGG - Intronic
1059249949 9:112879589-112879611 TCAGGGATCCCTGGTGGATGGGG - Exonic
1059357524 9:113711537-113711559 TGTGAGGTCCCTTGGGGAGGAGG + Intergenic
1059458635 9:114415553-114415575 TCTGGGGTACTTGGGGAGAGAGG - Intronic
1060155468 9:121317136-121317158 TCAGGGCCCCCTGGGCGAAGGGG - Exonic
1060596540 9:124852342-124852364 TCTAGGCTCCCTGGGGGCAGGGG - Intergenic
1060748953 9:126156197-126156219 TTTGGGGTCCCTATGGGCAGTGG + Intergenic
1060767649 9:126307058-126307080 ACTGGTGTCCCTAGGAGAAGAGG - Intergenic
1060878453 9:127100558-127100580 CCTTGGCTCCCTGGGGGCAGTGG + Intronic
1061015081 9:127976838-127976860 TCGGGGGTTCCTGGGGGTGGGGG + Intronic
1061214958 9:129216404-129216426 TGTGGGCTCCCTGAGGGCAGAGG - Intergenic
1061679296 9:132235078-132235100 GCTGGGGTCCCTGGTGAAAATGG + Intronic
1062240239 9:135533739-135533761 ACGGGGGTCGCTGGAGGAAGGGG + Intergenic
1062323286 9:136000980-136001002 AGTGAGGCCCCTGGGGGAAGGGG + Intergenic
1203792504 EBV:159427-159449 TCTCGGGTCCCTGGGAGGACAGG - Intergenic
1185599369 X:1328197-1328219 CCTGGGATCCCTGGGGAAGGGGG + Intergenic
1185651296 X:1649845-1649867 TCTGTGGACCCCGGGGGATGAGG - Intergenic
1185763905 X:2708916-2708938 TGTGGGGTCCATGGGGGCATTGG + Intronic
1185811716 X:3116417-3116439 TCTGGGGACTCTGGAGGAAAGGG + Intergenic
1187566408 X:20454034-20454056 ACTGGGGTCCTTAGAGGAAGAGG - Intergenic
1187928069 X:24268476-24268498 TCTGGGGGCCCAGTGGGTAGGGG - Intergenic
1189337560 X:40179465-40179487 TGTGCTTTCCCTGGGGGAAGAGG + Intergenic
1189360550 X:40347337-40347359 TCTGGGGACTCGGGGGGAAAGGG + Intergenic
1189400948 X:40667962-40667984 GCTGGGGTGTCTGTGGGAAGAGG + Intronic
1190100356 X:47518091-47518113 CCTGGGCTCCCTGGGGGATGGGG + Intergenic
1191604904 X:63050727-63050749 TCTGGTCTGCCTGGAGGAAGAGG - Intergenic
1193153814 X:78152178-78152200 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
1193221017 X:78927182-78927204 TTTGGGGACTCTGGGGGAAAGGG + Intergenic
1195439926 X:104887877-104887899 GCGCTGGTCCCTGGGGGAAGAGG - Intronic
1195812638 X:108851373-108851395 ACTGAAGTCCCTGGGGGAATGGG + Intergenic
1195850800 X:109279826-109279848 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1196127011 X:112111673-112111695 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1196657913 X:118239168-118239190 TCTGGGGTCCCTAGGAGAGAAGG + Intergenic
1197513754 X:127400140-127400162 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1198048910 X:132929921-132929943 CCTGATGTCTCTGGGGGAAGAGG - Intronic
1198369414 X:135975238-135975260 TCAGGGGTCACTGGAGGAACTGG - Intergenic
1199832042 X:151557093-151557115 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1200212326 X:154352241-154352263 CGTGGGGCCCCTAGGGGAAGGGG - Exonic
1200694772 Y:6349243-6349265 GCGCTGGTCCCTGGGGGAAGAGG + Intergenic
1201040505 Y:9825467-9825489 GCGCTGGTCCCTGGGGGAAGAGG - Intergenic
1201269576 Y:12241930-12241952 TCTGGGGACTCTGGGGGAAAGGG - Intergenic
1202271680 Y:23079804-23079826 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1202294346 Y:23340878-23340900 GCACTGGTCCCTGGGGGAAGAGG - Intergenic
1202424677 Y:24713548-24713570 GCACTGGTCCCTGGGGGAAGAGG + Intergenic
1202446112 Y:24956537-24956559 GCACTGGTCCCTGGGGGAAGAGG - Intergenic