ID: 1143514036

View in Genome Browser
Species Human (GRCh38)
Location 17:7410565-7410587
Sequence ACACCCCAGGGCCCCCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143514025_1143514036 26 Left 1143514025 17:7410516-7410538 CCATGTGGGCTGCCCATCCCAGC 0: 1
1: 0
2: 3
3: 102
4: 1394
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514029_1143514036 8 Left 1143514029 17:7410534-7410556 CCAGCACTCCCTACTCTCACACA 0: 1
1: 0
2: 2
3: 32
4: 420
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514027_1143514036 13 Left 1143514027 17:7410529-7410551 CCATCCCAGCACTCCCTACTCTC 0: 1
1: 0
2: 5
3: 88
4: 640
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514024_1143514036 29 Left 1143514024 17:7410513-7410535 CCTCCATGTGGGCTGCCCATCCC 0: 1
1: 0
2: 1
3: 27
4: 191
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514028_1143514036 9 Left 1143514028 17:7410533-7410555 CCCAGCACTCCCTACTCTCACAC 0: 1
1: 0
2: 2
3: 29
4: 358
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514026_1143514036 14 Left 1143514026 17:7410528-7410550 CCCATCCCAGCACTCCCTACTCT 0: 1
1: 0
2: 4
3: 46
4: 408
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514031_1143514036 0 Left 1143514031 17:7410542-7410564 CCCTACTCTCACACAGGCTCTGC 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1143514032_1143514036 -1 Left 1143514032 17:7410543-7410565 CCTACTCTCACACAGGCTCTGCA 0: 1
1: 0
2: 0
3: 33
4: 259
Right 1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143514036 Original CRISPR ACACCCCAGGGCCCCCTCAT GGG Intronic
900176367 1:1293133-1293155 ACACCCCAGAGCCTCCTCCCAGG - Exonic
900990774 1:6097211-6097233 CCACCACAGGGGCCCCTGATGGG - Intronic
901647256 1:10723347-10723369 ACACCCCAGAGCCCCCTAGGAGG - Intronic
907297356 1:53463921-53463943 ACAGCACAGGGCCCCATCAGAGG - Intronic
907928645 1:58978607-58978629 ACACCTCAGAGGCCCCTCAGAGG - Intergenic
909808199 1:79897901-79897923 ACACCACATTGCCCCCTCCTTGG - Intergenic
915217601 1:154350472-154350494 ACACCCCAGGGCCCTGTGGTGGG + Exonic
918099961 1:181364765-181364787 ACACCCCATGGCACCCTCAAGGG - Intergenic
920422128 1:205842082-205842104 ACCCCCCAGGCCCCTCTCCTTGG - Intronic
922219113 1:223544260-223544282 ACATCCCAGGGGCCCCTCTGTGG + Intronic
922619030 1:226979418-226979440 ACACCCCAGGCCCCACTAACAGG - Intronic
922757555 1:228105075-228105097 ACACCCCAGGGAGCCTTCCTGGG - Intronic
924708858 1:246518474-246518496 CCACACCAGGGGCCCCTCCTGGG - Intergenic
1063001135 10:1924042-1924064 TCCCCCCAGGGCCCTCTCAGAGG - Intergenic
1063243231 10:4192538-4192560 CCACCCCATGGCCCTCTCAAGGG - Intergenic
1063325196 10:5093114-5093136 ACACCCCAGCTTCCCCTCAATGG + Intronic
1063488893 10:6445257-6445279 CCACCCCGGGGCCCACTCCTGGG + Intronic
1063686604 10:8242528-8242550 ACACCCTCAGGCCCCCTCCTGGG - Intergenic
1065229077 10:23578568-23578590 TCACACCATGGCCCCCTAATAGG - Intergenic
1066594498 10:37035177-37035199 AAACACCAGGGCCCCCTTAAGGG + Intergenic
1069756174 10:70775622-70775644 ATTCCCTAGGGCCCCCTCACTGG + Intronic
1070685257 10:78475851-78475873 ACCCCACTGGGCCCCATCATGGG + Intergenic
1070803316 10:79256042-79256064 GCCCCCCAGGGCCCCTTCCTTGG + Intronic
1072469452 10:95698654-95698676 ACTGCCCAGGGCCACCTCAAGGG + Intergenic
1077177175 11:1196232-1196254 ACACCCCAGTGCCCCGCCACGGG - Intronic
1077351263 11:2094281-2094303 ACAGCCCAGGGCACTCTCCTGGG + Intergenic
1077467617 11:2741042-2741064 CCACCCCAGGGCGCCCCCAAAGG - Intronic
1077539309 11:3139157-3139179 TCACCCCAGGGTCCCCTGAACGG - Intronic
1077540485 11:3144338-3144360 ACACTCCAGCTCCCCGTCATGGG - Intronic
1079350260 11:19686100-19686122 CCACCCCAGGGCCTCCTCCTTGG + Intronic
1079924440 11:26476415-26476437 CCACACCAGGGCCCTCACATAGG - Intronic
1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG + Intronic
1083627196 11:64077854-64077876 GGAGCCCAGGGCCCCCTGATTGG + Intronic
1083887825 11:65581395-65581417 ACCCCCCATTGCCCCCTGATAGG + Intronic
1087347185 11:96986763-96986785 ACTTCCCAGGGCCTCCTCCTAGG - Intergenic
1089493743 11:118898533-118898555 TCCCCGCAGGGCTCCCTCATGGG - Exonic
1092071721 12:5636828-5636850 ACACCCCAGGTACCCCCCAGAGG - Intronic
1095098780 12:38161357-38161379 GCACCCCAGGGCCTCCTCGTGGG - Intergenic
1102696881 12:114806919-114806941 ACACCCCAGGGGCTCCTAATGGG - Intergenic
1102753746 12:115319965-115319987 ACACTCCTGGGCCCCGTCCTTGG - Intergenic
1122525003 14:102375513-102375535 TCACCCCAGGGCCCTTGCATTGG - Intronic
1122872052 14:104643316-104643338 CCACCCCAGAGCCCCCTTCTGGG + Intergenic
1125287132 15:38105753-38105775 CCAACCCAGGGCCACCTCACAGG - Intergenic
1129454776 15:75670780-75670802 ACTTCCCAGGGCCCCATCTTTGG + Intergenic
1130662094 15:85838757-85838779 ACATTCCAGGGCTCCCTCAGAGG + Intergenic
1131905749 15:97140296-97140318 ACCCGCCAGGGTCCCCTCAAGGG - Intergenic
1132614530 16:833562-833584 ACAGCCCAGGGCAGCCACATGGG + Intergenic
1132855257 16:2042096-2042118 AGACCCCAGGGCTGCCTCCTAGG - Intronic
1132986303 16:2769334-2769356 ACACCCCAGGGCCCCTTCTCTGG - Intronic
1134123273 16:11599478-11599500 CCAGCCCAGGGCTCACTCATGGG - Intronic
1134270523 16:12729100-12729122 TCACCCCAGGGCTCCCTCTGGGG - Intronic
1136194858 16:28644559-28644581 ACACCTCAGGGCGCCCTGAAAGG + Intronic
1136230620 16:28883346-28883368 AGACCCCAGCGCCCCATCACAGG + Intronic
1140519539 16:75569326-75569348 ACACCCCAGGGCCTGCCCACTGG + Intronic
1141709119 16:85687877-85687899 GCACCCCAGGACCCCAACATTGG - Intronic
1141926473 16:87173586-87173608 ACCCTCCAGGGCCCCCTTGTCGG + Intronic
1142104124 16:88292951-88292973 AGACCCCAGGGCCTCCCCAAGGG - Intergenic
1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG + Intronic
1143530962 17:7503138-7503160 GCGCCGCAGGGCCCTCTCATTGG - Exonic
1147957953 17:44147992-44148014 ACACCCCACTGCTCCCTCAGAGG + Exonic
1148031912 17:44627762-44627784 ACACCCCAGGCCCCAGTCAGAGG + Intergenic
1148820500 17:50356974-50356996 ACTCCCCAGAGCCCCCTCCCTGG + Intronic
1150569599 17:66374332-66374354 ACACCCCAGCGCTCCCCCACCGG - Intronic
1152067724 17:78120885-78120907 GCACCCCAGGGCCCCCACCAGGG + Intronic
1156453712 18:37281099-37281121 AAAGCCCAGGGCACCCTCAGTGG + Intronic
1157601331 18:48894834-48894856 CCACCCCAGAGCCCCTTCCTGGG + Intergenic
1160987994 19:1848397-1848419 GGGCCCCAGGGCCCCCTCACTGG + Exonic
1161315648 19:3616084-3616106 AAACCCCCGGGCCCCCTTGTGGG - Intronic
1161606556 19:5218329-5218351 CCACCCTGGGGGCCCCTCATTGG - Intronic
1161963661 19:7536025-7536047 GCACCCGAGGGGCCCCTCTTGGG + Intronic
1162464339 19:10831249-10831271 ACACCCCAGCGCCCCCTGCCTGG - Exonic
1163420299 19:17210364-17210386 ACATACCAGGACCCCCTCATAGG - Exonic
1163816218 19:19466050-19466072 CCAGCCCAGGGCACCCTCCTCGG + Intronic
1163837153 19:19581965-19581987 ACATCCCAGGGCACTCTCCTGGG - Intronic
1164694994 19:30236764-30236786 ACATCCCAGGGCACTGTCATGGG - Intronic
1165153425 19:33773782-33773804 ACACCCCAGGAGGCCCCCATAGG - Intergenic
1167591092 19:50404842-50404864 ACACCCCAGCGCCCCCTGGGAGG - Intronic
1168462457 19:56570540-56570562 ACAGCCCAGTGCCCTCTCAGAGG + Intronic
930086918 2:47504211-47504233 ACACTCCAAGGCCCCCTCAAGGG - Intronic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
932479010 2:72027599-72027621 ACACCACACGGCCTCCTCCTGGG - Intergenic
932572676 2:72946133-72946155 CCACTCCGGGGCCCCCTCCTGGG + Intronic
933780484 2:85797245-85797267 ACACCCCAGGGCTCAGTCCTCGG + Intergenic
937151993 2:119692411-119692433 ACACCTCACGGCTCCCTCCTCGG - Intergenic
937211791 2:120278370-120278392 ACACCCCACGCCCGCCTCACTGG - Intronic
938210149 2:129460161-129460183 AAACCCCAGGGCCTCCTCCTAGG - Intergenic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
939070589 2:137536140-137536162 ACACGGCAGGGCCCCCTAACAGG - Intronic
939992483 2:148888406-148888428 CCACCACAGGGCCCCCTAATGGG - Intronic
941819197 2:169827764-169827786 CCACTCCAGGGCCTCCTCCTCGG - Exonic
941873792 2:170412862-170412884 ACTCCCCAGGCCTCCCTGATGGG - Intronic
946433427 2:219637615-219637637 CCCCTCCAGGGCCCCCTCAGGGG - Exonic
946740560 2:222796973-222796995 AGAGCCAAGGGCCCCCTCCTGGG - Intergenic
947621439 2:231593697-231593719 TCTCCCCAGGGCCACCTCGTGGG - Exonic
948157114 2:235792492-235792514 ACACCACAGGGCGACCTCAAAGG - Intronic
948632326 2:239310102-239310124 AAACCCCAGGACCCCCTGCTGGG + Intronic
948653923 2:239465155-239465177 ACCCCACAGGGCCGCCTCACAGG + Intergenic
948771713 2:240254712-240254734 ATGCCCCAGGGGCCCCTCTTTGG + Intergenic
1168773225 20:429076-429098 TCACCCCAGGGCCCCAGCGTGGG - Exonic
1171203181 20:23257866-23257888 ACACCACAGGGTCACCTCATAGG + Intergenic
1171342933 20:24444779-24444801 ACACAGCAGGGACCCCTCTTAGG - Intergenic
1176108159 20:63399176-63399198 AGACCCCACGGCCCCCTCCAAGG - Intergenic
1176868730 21:14071087-14071109 GCACCCCAGGACCTCCTCGTGGG + Intergenic
1177342093 21:19816530-19816552 ACACACCGGGGCCTCTTCATGGG + Intergenic
1179680609 21:43018591-43018613 ACTCCCCAGGGTCCCCACAAAGG + Intronic
1182686398 22:32123735-32123757 CCACCCCAGGGCCCAGTCACTGG + Intergenic
1183153462 22:36055723-36055745 ACACCCCCGCGCCCCCACAGCGG - Intergenic
1184508882 22:44920367-44920389 ACACCCCAGGGCCCGCCCGAGGG + Intronic
1184677561 22:46052129-46052151 AAATCCCAGGGCCCCCACTTTGG + Intronic
1185011263 22:48315981-48316003 AGACCCCAGGACCACCTCCTGGG - Intergenic
1185319531 22:50194071-50194093 ACCCCCAAGGTCGCCCTCATGGG + Intronic
949524635 3:4891213-4891235 ACACCCCAAAGCCCCCTTACAGG - Intergenic
950582336 3:13870772-13870794 CAACCCCAGGGCCACCTCTTGGG - Intronic
953561833 3:43998269-43998291 CCTCCCCACGGCCCCCTCTTGGG - Intergenic
959339099 3:105105569-105105591 ACACCACAGGGCTCCCAAATGGG + Intergenic
961749565 3:129087315-129087337 ACACCCCAGGTTCCTCCCATTGG - Intergenic
967128775 3:186451517-186451539 AGACCACAGGGCCTCTTCATGGG + Intergenic
968065443 3:195756359-195756381 ACACCGCAGGGCCCTCTGCTGGG + Intronic
968552871 4:1232997-1233019 AGACCCCAGGACCCCCTCTCAGG - Intronic
968889759 4:3362187-3362209 ACACCCCATGTCCCCCACCTCGG - Intronic
969343306 4:6555986-6556008 CCACCCCAGGGCTCACTCTTGGG - Intronic
970056815 4:11983141-11983163 ACACACCAGAGGCCCCTCCTCGG - Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
980555648 4:134400348-134400370 TCACCCCAGGTCCCCATCAATGG - Intergenic
985896990 5:2754717-2754739 ACATCCCAGGCCCTCCTCTTCGG - Intronic
987838505 5:23191945-23191967 ACACCCCATGTCTCACTCATAGG + Intergenic
988969283 5:36449766-36449788 ACACTGCAGGGCCTCCCCATGGG - Intergenic
992865621 5:80954373-80954395 TCACCCCGGGGCCCTCTCCTGGG - Intergenic
997750163 5:136336670-136336692 ACACCCCAGGGGCCTGTCCTGGG - Intronic
1002184156 5:177446599-177446621 ACCCGCCAGGGCACCCTCACAGG - Intronic
1007920849 6:45608213-45608235 AGTCCCCAGGACCCCGTCATGGG - Intronic
1009987152 6:70794630-70794652 ACACCCCATGTTCCACTCATAGG - Intronic
1011412001 6:87075532-87075554 ACACCTCAGGGCTTTCTCATGGG + Intergenic
1014014961 6:116519330-116519352 ACATTCCAGAGCCCCCCCATAGG - Exonic
1018690896 6:166342997-166343019 CGCCCCCAGGGCCACCTCATGGG - Intergenic
1018908853 6:168090400-168090422 ACAGCCCAGGGACCCCTTAGTGG - Intergenic
1019313668 7:374897-374919 ACACCTCAGGGCTCACTCAGCGG - Intergenic
1020279295 7:6642319-6642341 ACACCACACGGTCCCCTCACAGG - Intronic
1023567850 7:41541153-41541175 ACTCCCCAGGGCCCCACCAGGGG + Intergenic
1024256508 7:47543797-47543819 ACACCCCAGGGGACTCCCATGGG - Intronic
1026154500 7:67815305-67815327 ACACCACAGGCTCCCTTCATGGG - Intergenic
1027200201 7:76059444-76059466 CCACCCCAGGCCCCACTCACTGG + Intronic
1030090103 7:105850810-105850832 ACACACCAGGGCCCCCACTGAGG - Intronic
1035105027 7:156434974-156434996 ACTCCTTAGTGCCCCCTCATGGG - Intergenic
1037805485 8:22056059-22056081 CCACCCCAGGAGCCTCTCATTGG - Intronic
1039898060 8:41730241-41730263 AGCCCCCAGGGCGGCCTCATGGG - Intronic
1045064543 8:98434066-98434088 ACACCTCAGGGCCCCTTCTGGGG - Intronic
1048907061 8:139098567-139098589 ACACCCCAGTGGCCCCTCCTGGG + Intergenic
1049028458 8:140014158-140014180 ACACCCCACGCCCCGCTCAGAGG + Intronic
1049218265 8:141417594-141417616 GCTCCCCCTGGCCCCCTCATGGG - Intronic
1049238296 8:141523801-141523823 ACACCGCAGGTCCCCCGCCTTGG - Intergenic
1049282423 8:141756955-141756977 ACAGCCCAAGTCCCCCTCTTTGG + Intergenic
1053010031 9:34627874-34627896 ATTCCCCAAGGCCCCCTCAGGGG + Exonic
1056681797 9:88725493-88725515 ACACCCCACTGCCCCCTCTATGG - Intergenic
1060601155 9:124878691-124878713 GCACCCCAGGCCCCACTCCTCGG - Exonic
1061508952 9:131048930-131048952 CTACCCCAGGGCCCCCACCTGGG + Intronic
1062176230 9:135164488-135164510 CCACCCCCCAGCCCCCTCATCGG - Intergenic
1186555674 X:10555898-10555920 ACACCCCAGGGCCCCTACAGTGG + Intronic
1189872345 X:45397264-45397286 CTACCCCAGGGCCCCATCAAGGG - Intergenic
1197408236 X:126082235-126082257 ACACCCCAGGGCCTACTTAAGGG - Intergenic
1199998952 X:153046616-153046638 TGTCCCCGGGGCCCCCTCATGGG + Intergenic
1200138756 X:153886992-153887014 CCTCCCCAGTGCCCCCTCCTAGG + Intronic
1200216164 X:154369109-154369131 ACAGCCCAGCCCCTCCTCATAGG - Intronic
1201563528 Y:15343323-15343345 TCACCCCAGTGCCTCCTGATGGG - Intergenic