ID: 1143514153

View in Genome Browser
Species Human (GRCh38)
Location 17:7411117-7411139
Sequence CTGGGCGAACCTGGTGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143514146_1143514153 3 Left 1143514146 17:7411091-7411113 CCCGTAATCTGGAAGAAGCCCTG 0: 1
1: 0
2: 0
3: 20
4: 136
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514144_1143514153 8 Left 1143514144 17:7411086-7411108 CCAACCCCGTAATCTGGAAGAAG 0: 1
1: 0
2: 1
3: 10
4: 87
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514140_1143514153 15 Left 1143514140 17:7411079-7411101 CCCCTGACCAACCCCGTAATCTG 0: 1
1: 0
2: 0
3: 8
4: 59
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514139_1143514153 23 Left 1143514139 17:7411071-7411093 CCAGCTCGCCCCTGACCAACCCC 0: 1
1: 0
2: 0
3: 18
4: 300
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514141_1143514153 14 Left 1143514141 17:7411080-7411102 CCCTGACCAACCCCGTAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514147_1143514153 2 Left 1143514147 17:7411092-7411114 CCGTAATCTGGAAGAAGCCCTGA 0: 1
1: 0
2: 1
3: 6
4: 202
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514143_1143514153 13 Left 1143514143 17:7411081-7411103 CCTGACCAACCCCGTAATCTGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165
1143514145_1143514153 4 Left 1143514145 17:7411090-7411112 CCCCGTAATCTGGAAGAAGCCCT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143514153 Original CRISPR CTGGGCGAACCTGGTGCTCC CGG Intronic