ID: 1143514502

View in Genome Browser
Species Human (GRCh38)
Location 17:7413076-7413098
Sequence AGATTCCGGCCTGAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143514500_1143514502 -9 Left 1143514500 17:7413062-7413084 CCTTGGAGGGAAGGAGATTCCGG 0: 1
1: 0
2: 2
3: 13
4: 183
Right 1143514502 17:7413076-7413098 AGATTCCGGCCTGAAAGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143514502 Original CRISPR AGATTCCGGCCTGAAAGTGC TGG Intronic
901032136 1:6313328-6313350 AGGTTGCGGCCAGAAAGTGGAGG + Intronic
904785606 1:32980336-32980358 AGATTGCGGCCAGCAAGTGCTGG + Intergenic
923273333 1:232376656-232376678 AGATTCGGGCCTGCCTGTGCAGG + Intergenic
924898229 1:248365683-248365705 TGATTCTGGACTGAATGTGCTGG + Intergenic
1071988724 10:91077944-91077966 AGATTGCGACCTGAAAGACCAGG - Intergenic
1076608963 10:131708475-131708497 AGCTTCCGGCCTCAATATGCTGG + Intergenic
1081434233 11:43009777-43009799 GGAATCCGGCTTGAAACTGCTGG - Intergenic
1081613926 11:44579401-44579423 TGAGGCCGGCCTGGAAGTGCAGG - Intronic
1095941766 12:47732131-47732153 AGAGTCCAGCCTGCATGTGCAGG + Intergenic
1098989349 12:77047787-77047809 AGATGCCTGCCGGAAGGTGCTGG + Intronic
1101149290 12:101869797-101869819 ATCTTCCTGCCTCAAAGTGCTGG + Intergenic
1104109006 12:125688484-125688506 AGCTGCCTGCCTGACAGTGCAGG + Intergenic
1105673913 13:22649901-22649923 AGCTTTGGGCCTGAAAGAGCTGG + Intergenic
1119887595 14:78155988-78156010 AGACTCCATCCTGAGAGTGCTGG + Intergenic
1123407388 15:20029388-20029410 AGATGCCGGGCTGAAGGTGGAGG + Intergenic
1123516715 15:21036044-21036066 AGATGCCGGGCTGAAGGTGGAGG + Intergenic
1126204454 15:46028250-46028272 AAATTCAGGCCTGATAGTGTAGG + Intergenic
1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG + Intronic
1142891662 17:2947909-2947931 AGATGCGGGCCAGAAAGTGCTGG - Intronic
1142955261 17:3517171-3517193 AGCTTCCTATCTGAAAGTGCTGG + Intronic
1143514502 17:7413076-7413098 AGATTCCGGCCTGAAAGTGCTGG + Intronic
1144063884 17:11607223-11607245 GGATTCCTGCCTGAGAGTGATGG + Intronic
1144626223 17:16845684-16845706 AGATCCCGGCCTGCAGGAGCCGG + Intergenic
1144880210 17:18427036-18427058 AGATCCCGGCCTGCAGGAGCCGG - Intergenic
1145152025 17:20517348-20517370 AGATCCCGGCCTGCAGGAGCCGG + Intergenic
1159790938 18:72778074-72778096 AGACTACTGCCAGAAAGTGCCGG + Intronic
925159455 2:1673769-1673791 AGATTCCCGCCTAAACTTGCTGG - Exonic
925172056 2:1756029-1756051 AAATTCCAGCCGGAAAGAGCAGG + Intergenic
925901372 2:8511584-8511606 TGATTGCAGCCTGAAAGAGCTGG - Intergenic
930307087 2:49688125-49688147 ATATTCTGACCTGAAAGTGATGG - Intergenic
934675774 2:96248766-96248788 AGAATGGGGCCTGAAGGTGCAGG - Exonic
943127427 2:183812043-183812065 AAATTCTGTCCTGAAAGAGCTGG + Intergenic
948722747 2:239911824-239911846 GGAATCTGGCCTGAAACTGCTGG - Intronic
1172571721 20:35975799-35975821 AGAGGCAGGCCTGAAAGGGCCGG + Intronic
1175866966 20:62183927-62183949 AGATTCCTGCCGTAAAATGCAGG + Intronic
954579928 3:51697675-51697697 AGATGCCTGCCTCTAAGTGCTGG + Intronic
957035748 3:75290867-75290889 GGAGTTCTGCCTGAAAGTGCTGG + Intergenic
961304286 3:125945845-125945867 GGAGTTCTGCCTGAAAGTGCTGG - Intergenic
963778724 3:149465552-149465574 AGATACAGCCCTGAAAGTCCCGG + Intergenic
979782847 4:124677036-124677058 ATATTCCTACCTGAAAGTGTTGG - Intronic
984197982 4:176682683-176682705 AGACGTCGGCCTCAAAGTGCTGG - Intergenic
985478816 5:94506-94528 AGGTTCCATCCTGAAAGTGTTGG + Intergenic
993483439 5:88452522-88452544 AGATTCAGGCCTGTTAGTGTAGG - Intergenic
994430720 5:99656889-99656911 AGATTCAGGCATGTAAGTACAGG - Intergenic
1002132850 5:177092057-177092079 ATATGCTGGCCTGCAAGTGCAGG - Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007912055 6:45525640-45525662 AAATTAAGGCCTGAAAGGGCAGG + Intronic
1020087169 7:5316761-5316783 AGATGCCGGGATGAACGTGCAGG + Intronic
1025207136 7:57000397-57000419 AGATGCCGGGATGAACGTGCAGG - Intergenic
1025664800 7:63576493-63576515 AGATGCCGGGATGAACGTGCAGG + Intergenic
1026616990 7:71914069-71914091 AAATTCCGGGGTAAAAGTGCAGG + Intronic
1027128330 7:75573023-75573045 AGATTCCTGGGTGAAAGGGCGGG + Intronic
1031977341 7:128102476-128102498 AGCCTCTGGCCTGAAAGGGCTGG - Intergenic
1034220830 7:149444833-149444855 AAATTCCGTGCTGAAAGTGTAGG + Intronic
1035340251 7:158156156-158156178 ATATTGCGGCATGACAGTGCAGG - Intronic
1036062491 8:5339683-5339705 AGATTCCGGCTGGAAACTGATGG + Intergenic
1038510745 8:28132323-28132345 AGATTCCGGTTTTAAAGTGGTGG + Exonic
1041464865 8:58147549-58147571 AGATTCTGGCCTGAAACTTTTGG - Exonic
1044662238 8:94602789-94602811 AAATTTCAGCCTGAAATTGCTGG - Intergenic
1050282799 9:4069282-4069304 AGATTCTGGCCTGAAACTATTGG + Intronic
1052210551 9:25898134-25898156 AGATACCGGCTTGTATGTGCTGG + Intergenic
1059385557 9:113961521-113961543 AGACCCTGGCCTGAAAGAGCTGG - Intronic
1196104551 X:111882383-111882405 AGAGTACGGCCTGAAACTGCAGG + Intronic
1201762139 Y:17552204-17552226 TGATTCCGGCTTGTAACTGCTGG - Intergenic
1201839413 Y:18353784-18353806 TGATTCCGGCTTGTAACTGCTGG + Intergenic