ID: 1143514613

View in Genome Browser
Species Human (GRCh38)
Location 17:7413590-7413612
Sequence GATCACATGTGGCAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143514610_1143514613 2 Left 1143514610 17:7413565-7413587 CCAATCTGGAGCAACTCAAGGGC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 89
1143514604_1143514613 27 Left 1143514604 17:7413540-7413562 CCTCTGGAATTAGTCACCCTTCA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 89
1143514607_1143514613 10 Left 1143514607 17:7413557-7413579 CCTTCAGTCCAATCTGGAGCAAC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 89
1143514606_1143514613 11 Left 1143514606 17:7413556-7413578 CCCTTCAGTCCAATCTGGAGCAA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143514613 Original CRISPR GATCACATGTGGCAGTGATC AGG Intronic
903255739 1:22098078-22098100 GATCACTTGTCTCAGTCATCAGG + Intergenic
903504599 1:23824617-23824639 TAACACATCTGGCAGTGTTCTGG - Intronic
906330720 1:44881863-44881885 GATCAAATGTGGCATTGACTTGG + Intronic
906699745 1:47849333-47849355 GTTCACAGATGGCAGTGTTCTGG - Intronic
907110477 1:51922207-51922229 TATCACAAGTGGCAGTGTTTGGG + Intronic
908326817 1:63031226-63031248 GATCACATTTGGAAGTACTCTGG - Intergenic
908565697 1:65353930-65353952 GATCAACTTTGGCAGTGATCTGG - Intronic
911205783 1:95090394-95090416 CATTACATGTGCCAGTGATAGGG - Intergenic
915361555 1:155289025-155289047 GTCCACAGGTGGCAGTGAGCGGG - Exonic
1066277351 10:33881886-33881908 GGTCACAGGTGACAGTGATACGG + Intergenic
1069922254 10:71823196-71823218 GCTCAGAGGTGGCAGTGTTCAGG + Intronic
1073143195 10:101262311-101262333 GACCACTTGAGGCAGGGATCTGG + Intergenic
1076871320 10:133196382-133196404 ACTCTCATGTGTCAGTGATCAGG + Intronic
1081010623 11:37806886-37806908 AATCTCATGTGGCATTGATCAGG - Intergenic
1081865362 11:46356728-46356750 GCTAACATGTGGCAGTGCTGGGG - Intronic
1083868034 11:65469008-65469030 GACCACAGGTGGGTGTGATCAGG - Intergenic
1089779848 11:120866103-120866125 AGTCTCATGTGGCAGTGACCCGG - Intronic
1090339933 11:126008866-126008888 GATCTCTTGTGGCAGTGTTAAGG - Intronic
1093230230 12:16534883-16534905 GATCAGATTTGGTAGTGTTCAGG - Intronic
1099195391 12:79609351-79609373 CATCACATATGGAAGTGATAGGG + Intronic
1106349467 13:28914528-28914550 GAGCAAATGTGGCAATGATAAGG + Intronic
1110373447 13:74765522-74765544 GAACACAGGTGGCACTGATTTGG + Intergenic
1112684627 13:101810505-101810527 CATGACATGTAGCAGTGATATGG - Intronic
1126222237 15:46227533-46227555 GATCATAAGTGGCAGTCATTTGG - Intergenic
1129550753 15:76446340-76446362 GATCACTTGTTGCAGTGCCCTGG - Intronic
1132145877 15:99429698-99429720 GATCACATGTCACAGAGCTCAGG - Intergenic
1140410628 16:74738544-74738566 GAACAAATGTGGCAGCCATCAGG - Intronic
1140866577 16:79067543-79067565 TATTCCATGTGGCAGTGGTCAGG - Intronic
1143514613 17:7413590-7413612 GATCACATGTGGCAGTGATCAGG + Intronic
1144578153 17:16442922-16442944 GATGCCATGTGGTAGTGCTCAGG - Intronic
1148999303 17:51740685-51740707 GAGCACATGTGTGAGTGATGGGG - Intronic
1149134552 17:53348930-53348952 GATCTCATGTGGCAGGTATGTGG + Intergenic
1156645099 18:39151635-39151657 GAGCAGGTGAGGCAGTGATCTGG - Intergenic
1156964824 18:43078436-43078458 TTATACATGTGGCAGTGATCAGG - Intronic
1157632496 18:49112428-49112450 GATCACCTGTGGCAGAGCACAGG - Intronic
1160504852 18:79421305-79421327 GATGACATGTGGCACAGACCTGG + Intronic
1164553967 19:29235462-29235484 TATCACATGAGGTAATGATCTGG + Intergenic
1165946778 19:39448169-39448191 GATTTCATGTGGCTGTGTTCTGG + Intronic
933313490 2:80688908-80688930 AAACACATTTGGCAGTGATCAGG + Intergenic
934576154 2:95402777-95402799 GGTCACTGGTGGCAGTGCTCAGG + Exonic
936475648 2:112837468-112837490 GAGCTCATCTGGCATTGATCTGG - Intergenic
938613578 2:132974319-132974341 GTTCACATGAGGCAGAGATCAGG + Intronic
939661051 2:144890268-144890290 CATCACATGTAAAAGTGATCTGG - Intergenic
939807016 2:146786515-146786537 AGTCACATGTGGGAGTGAACAGG - Intergenic
940124327 2:150307811-150307833 GGAGTCATGTGGCAGTGATCTGG - Intergenic
941421117 2:165283868-165283890 TTTCAAATGTGGGAGTGATCAGG - Intronic
944618778 2:201490314-201490336 GCTCCCATGTGCCAGTTATCTGG - Intronic
946289431 2:218732732-218732754 GATGACCTGTGGCAGTGATTGGG + Intronic
947899465 2:233708766-233708788 GATCACAGGTTGCATTGATTTGG - Intronic
1170774759 20:19365516-19365538 GAACATGTGAGGCAGTGATCTGG + Intronic
1172930105 20:38580329-38580351 GATGACATGTGGAAGTGTTCTGG + Intergenic
1173835951 20:46125848-46125870 CTTCACACTTGGCAGTGATCTGG + Intronic
1174948218 20:55012509-55012531 CATCTCATATGGTAGTGATCAGG + Intergenic
1176901431 21:14446878-14446900 GATAACATGTAGCAATGTTCTGG + Intergenic
1179544528 21:42105407-42105429 GTTCTCATTTGGCAGGGATCTGG - Intronic
1180348877 22:11781203-11781225 AATCACCTGGGGCAGTGATGCGG + Intergenic
1181276428 22:21689965-21689987 GACCACGTGTGACAGTGAGCTGG - Intronic
1181417239 22:22769388-22769410 GAACACATGTGGCAGGAACCAGG + Intronic
1183079906 22:35449654-35449676 GCTGACATGTGGCAGTTTTCCGG + Intergenic
1184985937 22:48134133-48134155 GATAACATGTGGCAGAAACCTGG - Intergenic
953761512 3:45690829-45690851 GAGCACATGTGACAGTGGCCTGG - Intronic
955993046 3:64649063-64649085 GATAACATCTAGCAGTTATCCGG - Intronic
966218805 3:177530339-177530361 GCTGACATGTGGCAGGGCTCTGG - Intergenic
969238440 4:5884090-5884112 GAACAAATGTGCCAGTGATTAGG - Intronic
972154013 4:36134370-36134392 GAAGACATGTGGCAGTGGTTGGG - Intronic
976055940 4:81067125-81067147 GATCACTTGTGACAGTGAAAAGG - Intergenic
981296161 4:143134161-143134183 TATTACATGTGGCAGTGAAGAGG - Intergenic
982769751 4:159385975-159385997 GACCTCATCTGGCAGTAATCAGG + Intergenic
984256024 4:177391107-177391129 GAAGAGATGTGGCAGTGAGCCGG - Intergenic
990963258 5:61416912-61416934 GATCACCTCGGTCAGTGATCAGG + Intronic
991001784 5:61790334-61790356 GACTCCAGGTGGCAGTGATCAGG + Intergenic
995038632 5:107563660-107563682 GATCACTTGTGGCCGGGAGCTGG - Intronic
995952850 5:117737863-117737885 GATGAGATGTGACAGTGATTAGG + Intergenic
1000280824 5:159780487-159780509 CATCACATGAGGAAGTGCTCAGG - Intergenic
1002592114 5:180298055-180298077 CATCACATGTGGCAGGGGTTAGG - Intergenic
1003254108 6:4459485-4459507 GATCAGATGGGCCAGAGATCAGG + Intergenic
1007126517 6:39430245-39430267 GAGAACATGTGGCAGTGCTGAGG - Intronic
1007297339 6:40834966-40834988 AATCCCATGTGCCAGTCATCTGG - Intergenic
1008040593 6:46794486-46794508 GATCATAGGTAGCAGTGATGGGG + Intronic
1018058899 6:160074770-160074792 CATTATATGTGGCAGTGATATGG + Intronic
1019225263 6:170503237-170503259 GGTCACATCTGGCAGCCATCTGG + Intergenic
1033890545 7:146007614-146007636 GATTTCATGTGGCAGTGTTGGGG + Intergenic
1034060399 7:148082082-148082104 GATTACAGGTGGGAGTCATCAGG + Intronic
1034716930 7:153252083-153252105 AATCACACGTGGCAGTGCTGAGG + Intergenic
1036121180 8:6019585-6019607 GATCACATGTGTTATTGCTCTGG + Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1038702207 8:29859351-29859373 CATCAGAAGTGGGAGTGATCAGG - Intergenic
1040875888 8:52151594-52151616 GAGCACACGTGGCACTGATATGG - Intronic
1045026279 8:98089970-98089992 GAGCATATGTGGAAATGATCAGG + Exonic
1046766675 8:118076618-118076640 GAGCACTTGTGGCAGGGATTGGG - Intronic
1047905205 8:129465776-129465798 GGTCAGATCTGGCAGTGATGAGG + Intergenic
1057294334 9:93826678-93826700 GGTCACATGTGGGAGTCATCAGG + Intergenic
1059738404 9:117125472-117125494 GTTCACATGTGGCATTAATGTGG + Intronic
1060681076 9:125565330-125565352 GATCACATTTGGGAGAAATCTGG - Intronic
1185916559 X:4041943-4041965 GATGACAAGTGCCAGTGATGAGG + Intergenic
1187354561 X:18554909-18554931 GATCACTTGTTGAAGAGATCAGG - Intronic
1197837141 X:130706966-130706988 GATCACCTCTGGCAGTAATCTGG + Intronic
1199862240 X:151811610-151811632 GTTCCCATGTGTCAGTAATCTGG + Intergenic