ID: 1143519395

View in Genome Browser
Species Human (GRCh38)
Location 17:7437023-7437045
Sequence CGGTGCCGCCACCGGGCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143519395_1143519406 28 Left 1143519395 17:7437023-7437045 CCTGGTGCCCGGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143519406 17:7437074-7437096 CTGTTTTGCCCGCCAGGAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 107
1143519395_1143519405 22 Left 1143519395 17:7437023-7437045 CCTGGTGCCCGGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143519405 17:7437068-7437090 GCAGCTCTGTTTTGCCCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1143519395_1143519400 0 Left 1143519395 17:7437023-7437045 CCTGGTGCCCGGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1143519400 17:7437046-7437068 AGCGGCCGTGCGCCTCCGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143519395 Original CRISPR CGGTGCCGCCACCGGGCACC AGG (reversed) Exonic
900109881 1:1000871-1000893 TGGTGACGTCACCAGGCACCCGG + Intergenic
900186749 1:1336470-1336492 CGGAGCAGCCGCCGGGCCCCGGG - Exonic
900191854 1:1355429-1355451 CGGTGCGGGGACCGGGGACCGGG - Exonic
900583803 1:3422873-3422895 CTGAGCTGCCTCCGGGCACCCGG - Intronic
916108640 1:161447903-161447925 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916110228 1:161455284-161455306 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916111813 1:161462694-161462716 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916113400 1:161470075-161470097 CCGTGTCCCCGCCGGGCACCTGG - Intergenic
916588180 1:166166249-166166271 CCGTGCCGGCACCGGGCTGCAGG - Exonic
917944562 1:179955212-179955234 TCTTGCCGCCACCGGGGACCCGG - Intronic
922935653 1:229420226-229420248 AGGTTCCGCCCCAGGGCACCTGG + Intergenic
923734852 1:236596424-236596446 CAGTACCTCCACAGGGCACCTGG + Intronic
1062798769 10:363934-363956 CGGAGCCTCCACTGTGCACCAGG + Intronic
1073099579 10:100999744-100999766 CGGTGCCGCCCACTCGCACCGGG + Exonic
1077176762 11:1194669-1194691 CGGTGAGGCCACAGGGCTCCCGG + Intronic
1083184346 11:61008550-61008572 AGGCGCCGCCACCGTCCACCAGG - Exonic
1084295968 11:68213554-68213576 CGGTGCCGCCTCCGGTTCCCGGG + Intronic
1085474817 11:76783251-76783273 CCGAGCCGCCACCCGGCGCCCGG + Intronic
1088462234 11:110093511-110093533 CGGGGCCGCGCCCGGGCGCCAGG + Intronic
1089432687 11:118436644-118436666 CGGGGCCGCCACCGCCGACCGGG - Exonic
1092455155 12:8636477-8636499 CGGTGCCGGCGCCGGTCCCCTGG + Intergenic
1095962616 12:47844906-47844928 CGCTGCCGCCACCCGCCCCCGGG - Exonic
1097641752 12:62191266-62191288 TGTTGCCGCCACCGGGAAGCGGG - Exonic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1103074158 12:117968909-117968931 TGCTGCCGCCGCCGGGCTCCGGG + Intronic
1104908856 12:132230014-132230036 CGGTGCCGCCCCCTTGAACCTGG + Intronic
1106776897 13:33017178-33017200 CGGCTACGCCACCGGGCGCCTGG + Exonic
1108615587 13:52128973-52128995 CGGAGCCGCCACAGGGCTTCGGG - Intronic
1113467297 13:110521142-110521164 CAGTGCCGCCACAGGCCCCCTGG - Intergenic
1113882594 13:113635935-113635957 TTGTGCCGCCACGGGCCACCTGG + Intronic
1115566593 14:34630062-34630084 CGCTGCCCCCACCGCGCTCCCGG + Intronic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1119325760 14:73758994-73759016 CGGCGCTGCCGCCAGGCACCAGG + Intronic
1121314309 14:92952065-92952087 CACTGCCGCCACCTGACACCAGG + Intronic
1122666619 14:103334447-103334469 AGGTGCCGCCGCCGAGCAGCGGG - Exonic
1122887142 14:104715100-104715122 GGGGGCGGACACCGGGCACCAGG + Intronic
1124584420 15:30991817-30991839 AGGGCCCGCCAGCGGGCACCTGG - Intergenic
1132491560 16:234687-234709 CGCTGCCTCCGCCGGGAACCTGG - Exonic
1132556241 16:573959-573981 AGGTGCAGCCACAGGGCCCCAGG - Intronic
1132567768 16:631129-631151 CGGTGCCCCCACCAGGACCCCGG - Exonic
1132646954 16:1003572-1003594 CGGGACCACCACCGGGCTCCTGG - Intergenic
1132854159 16:2037371-2037393 CGGGGCAGGCACCGGGCGCCTGG - Intronic
1132984312 16:2756340-2756362 TGGTGCCCCCCCCGGGCACGGGG + Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133191377 16:4136002-4136024 CAGTGAAGCCACCGGGCACAAGG + Intergenic
1138105634 16:54285972-54285994 CGCTGCCGCCAGCGGCCCCCGGG + Exonic
1139840114 16:69871862-69871884 CGGTGCCGGCTCCGAGCACCGGG - Exonic
1141699028 16:85634017-85634039 CGGGGCTGCCGCTGGGCACCAGG - Exonic
1143174844 17:4949875-4949897 CGGGGCCGCACCCGGGCACGTGG + Intronic
1143519395 17:7437023-7437045 CGGTGCCGCCACCGGGCACCAGG - Exonic
1147393347 17:40122867-40122889 CGGGGCGGCCCCCGGGCAGCAGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150778605 17:68101476-68101498 CGGTGCCCGCTCCGGGCATCTGG + Intergenic
1152210111 17:78998648-78998670 CAGTGCAGCCATGGGGCACCAGG + Intronic
1152552214 17:81035444-81035466 CGGCGCGGCCACCCGGGACCCGG + Intronic
1156473315 18:37390871-37390893 CTGGGCCTGCACCGGGCACCTGG - Intronic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160201823 18:76802194-76802216 CTCTGCCGCCACCTGGCGCCCGG - Intronic
1160786706 19:903470-903492 CACCGCAGCCACCGGGCACCCGG + Intronic
1160810439 19:1010794-1010816 AGGCGCCGCCACTGGGCCCCGGG - Exonic
1160930759 19:1568452-1568474 CGGGGCCGGCGCCGGGCACGTGG + Intergenic
1161573457 19:5042796-5042818 CGGTGCAGCCACCTCCCACCCGG + Intronic
1163304495 19:16469357-16469379 GGCTGCAGCCACAGGGCACCGGG + Intronic
1163490816 19:17616352-17616374 GGGCGCAGGCACCGGGCACCAGG + Intronic
1166961021 19:46495783-46495805 CGGCGCCGCCCCCCTGCACCTGG - Exonic
1167298371 19:48664656-48664678 CGGTGCCGCCACCACACAGCTGG - Exonic
1168495030 19:56840641-56840663 TGGTGGCGCCGCCGGGCGCCGGG - Exonic
1168567887 19:57439980-57440002 GGGTGTCTCCACTGGGCACCTGG + Intronic
931695035 2:64865153-64865175 GGGGGCAGCCACCGGGCACAGGG - Intergenic
935219000 2:100995833-100995855 CGATGCCTACACGGGGCACCTGG - Exonic
942027209 2:171922343-171922365 CGCTTCCGCCGCCGGGCTCCTGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946295772 2:218782324-218782346 CGTTGCCGCCGCCGGACACCAGG - Exonic
948796475 2:240405166-240405188 GGGTGCCGCCAGTGGGCACAAGG - Intergenic
948859643 2:240746613-240746635 CCGTGCCGTCACCTGGAACCTGG - Intronic
1172587129 20:36092747-36092769 CGGGGCAGCCGCCGGACACCAGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1181111507 22:20605516-20605538 CCCTGCAGCCACCAGGCACCAGG - Intergenic
1184222749 22:43111130-43111152 CAGTGCGGCTTCCGGGCACCCGG + Intronic
953912207 3:46898885-46898907 CGGTGCCGCCACTGGCCTCGTGG + Intronic
954113139 3:48446904-48446926 CCGGCCCGCCGCCGGGCACCGGG + Exonic
966982672 3:185152840-185152862 CGGAGCCGACACCGGGAGCCCGG + Exonic
968568541 4:1327556-1327578 GGGTGCGGCACCCGGGCACCTGG + Intronic
968907797 4:3462708-3462730 CAGTGCCGCCTCAGGGCCCCAGG - Intergenic
969289720 4:6230895-6230917 CAGGGCGGCCACCGGCCACCAGG + Intergenic
969298162 4:6281573-6281595 CTGTGCCACCACCGTCCACCTGG - Intronic
969694121 4:8725291-8725313 CCGGGCCGCCACAGGGCAGCTGG + Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
989272985 5:39554339-39554361 CGGAGCCTCCACCTGGCCCCAGG + Intergenic
999257895 5:150219999-150220021 TGGTGCCACCACAGGGCACCAGG - Intronic
1002185886 5:177454689-177454711 CGGTGACGTCACCGGGCCCCCGG + Intronic
1003427736 6:6008763-6008785 CGGGGCCGCCACCGTGCCCCTGG - Intergenic
1007066641 6:38997294-38997316 CTGTTCCCCCACCGGCCACCAGG + Intronic
1007785275 6:44276206-44276228 CCGCGCCCCCACCGGGCCCCGGG - Exonic
1008381867 6:50845957-50845979 CAGCGCCGCCAGCGGCCACCCGG + Exonic
1012578250 6:100829547-100829569 AGGCGCCGCCAGCGGGAACCAGG - Intronic
1019466783 7:1194021-1194043 CAGTGCCACCCCCTGGCACCCGG - Intergenic
1021361836 7:19724300-19724322 CGGGGGCACCACCGGGCAGCTGG + Intronic
1024520874 7:50303803-50303825 CGGGCCCGCCACCCTGCACCCGG - Intergenic
1026899008 7:74027156-74027178 CTGTTCCCCCACAGGGCACCTGG + Intergenic
1029271878 7:99381877-99381899 CGGGGCAGCCACCGGCCTCCTGG + Intronic
1035752513 8:2006591-2006613 CTGTGCAGCCTTCGGGCACCCGG + Exonic
1036665140 8:10732767-10732789 TGGGGCCGCGCCCGGGCACCAGG + Intronic
1037903853 8:22703839-22703861 GGGTGCCTCCCCCTGGCACCCGG - Intergenic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1042242693 8:66680628-66680650 CTCTGCAGCCACCTGGCACCCGG + Exonic
1045047582 8:98294108-98294130 CGGTGGCGCCCGCGGGCCCCGGG - Exonic
1045222582 8:100213280-100213302 CGGCGGCGCCACCGGGCATCCGG + Exonic
1054143691 9:61547864-61547886 GGGTGCCCCCTCCGGGCACCAGG + Intergenic
1061002893 9:127912383-127912405 AGGTGCGGCCGCCGAGCACCCGG + Exonic
1061975451 9:134066187-134066209 CGGTGCCTCAGCAGGGCACCGGG - Intronic
1062341574 9:136095760-136095782 CGGTGCAGCCTCCGGGATCCGGG + Intergenic
1062542057 9:137045878-137045900 TGGAGCCGCCGCCGGCCACCCGG - Exonic
1062744312 9:138201725-138201747 TGGTGCCGCCTCTGGGCAGCTGG + Intergenic
1187698169 X:21941123-21941145 CGGCGCGGCCGGCGGGCACCCGG - Intronic